The critical function of miR-1323/Il6 axis in children with Mycoplasma pneumoniae pneumonia

array:24 ["pii" => "S0021755720302515" "issn" => "00217557" "doi" => "10.1016/j.jped.2020.11.004" "estado" => "S300" "fechaPublicacion" => "2021-09-01" "aid" => "951" "copyright" => "Sociedade Brasileira de Pediatria" "copyrightAnyo" => "2020" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "J Pediatr (Rio J). 2021;97:552-8" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:18 [ "pii" => "S0021755720302527" "issn" => "00217557" "doi" => "10.1016/j.jped.2020.11.005" "estado" => "S300" "fechaPublicacion" => "2021-09-01" "aid" => "952" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "J Pediatr (Rio J). 2021;97:559-63" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Accuracy of neck circumference for diagnosing overweight in six- and seven-year-old children" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "559" "paginaFinal" => "563" ] ] "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1235 "Ancho" => 2508 "Tamanyo" => 178493 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0010" "detalle" => "Figure " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "ROC curves of the neck circumference as a predictor of obesity for the general population (A), male (B) and female (C)." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Eduarda Mucelin, Jefferson Traebert, Milcia Almeida Zaidan, Anna Paula Piovezan, Rodrigo Dias Nunes, Eliane Traebert" "autores" => array:6 [ 0 => array:2 [ "nombre" => "Eduarda" "apellidos" => "Mucelin" ] 1 => array:2 [ "nombre" => "Jefferson" "apellidos" => "Traebert" ] 2 => array:2 [ "nombre" => "Milcia Almeida" "apellidos" => "Zaidan" ] 3 => array:2 [ "nombre" => "Anna Paula" "apellidos" => "Piovezan" ] 4 => array:2 [ "nombre" => "Rodrigo Dias" "apellidos" => "Nunes" ] 5 => array:2 [ "nombre" => "Eliane" "apellidos" => "Traebert" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0021755720302527?idApp=UINPBA000049" "url" => "/00217557/0000009700000005/v1_202109160616/S0021755720302527/v1_202109160616/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S0021755720302564" "issn" => "00217557" "doi" => "10.1016/j.jped.2020.11.008" "estado" => "S300" "fechaPublicacion" => "2021-09-01" "aid" => "956" "copyright" => "Sociedade Brasileira de Pediatria" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "J Pediatr (Rio J). 2021;97:546-51" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Association between interleukin-10 polymorphisms and CD4+CD25+FOXP3+ T cells in asthmatic children" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => "en" "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "546" "paginaFinal" => "551" ] ] "contieneResumen" => array:1 [ "en" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 988 "Ancho" => 2925 "Tamanyo" => 171163 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0005" "detalle" => "Figure " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Association between IL-10 gene SNP rs3024491 and levels of IL-10 protein (a), asthma severity (b) and Tregs cells frequency (c). GG genotype, TG genotype, TT genotype; SNP, single nucleotide polymorphism; Tregs, regulatory T cells." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Magáli Mocellin, Lidiane Alves de Azeredo Leitão, Patrícia Dias de Araújo, Marcus Herbert Jones, Renato Tetelbom Stein, Paulo Márcio Pitrez, Ana Paula Duarte de Souza, Leonardo Araújo Pinto" "autores" => array:8 [ 0 => array:2 [ "nombre" => "Magáli" "apellidos" => "Mocellin" ] 1 => array:2 [ "nombre" => "Lidiane Alves" "apellidos" => "de Azeredo Leitão" ] 2 => array:2 [ "nombre" => "Patrícia Dias" "apellidos" => "de Araújo" ] 3 => array:2 [ "nombre" => "Marcus Herbert" "apellidos" => "Jones" ] 4 => array:2 [ "nombre" => "Renato Tetelbom" "apellidos" => "Stein" ] 5 => array:2 [ "nombre" => "Paulo Márcio" "apellidos" => "Pitrez" ] 6 => array:2 [ "nombre" => "Ana Paula Duarte" "apellidos" => "de Souza" ] 7 => array:2 [ "nombre" => "Leonardo Araújo" "apellidos" => "Pinto" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0021755720302564?idApp=UINPBA000049" "url" => "/00217557/0000009700000005/v1_202109160616/S0021755720302564/v1_202109160616/en/main.assets" ] "en" => array:19 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "The critical function of miR-1323/Il6 axis in children with Mycoplasma pneumoniae pneumonia" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "552" "paginaFinal" => "558" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Linlin Yin, Yajun Ma, Wenlong Wang, Yitang Zhu" "autores" => array:4 [ 0 => array:4 [ "nombre" => "Linlin" "apellidos" => "Yin" "email" => array:1 [ 0 => "Yinlinlin818@163.com" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] 1 => array:3 [ "nombre" => "Yajun" "apellidos" => "Ma" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 2 => array:3 [ "nombre" => "Wenlong" "apellidos" => "Wang" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 3 => array:3 [ "nombre" => "Yitang" "apellidos" => "Zhu" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] ] "afiliaciones" => array:2 [ 0 => array:3 [ "entidad" => "Cangzhou Central Hospital, Department of Clinical Laboratory, Hebei, China" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Tengzhou Central People’s Hospital, Department of Clinical Laboratory, Shandong, China" "etiqueta" => "b" "identificador" => "aff0010" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:8 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 2289 "Ancho" => 2925 "Tamanyo" => 373044 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0010" "detalle" => "Figure " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Comparisons of multiple miRNA between MPP cases and healthy controls. a, Levels of miRNAs in in the PBMCs from the MPP patients and healthy controls; b, Levels of miRNAs in MPP patients with pleura effusion and MPP patients without pleura effusion. Error bars indicate standard error. All qRT-PCR data are presented as the fold induction relative to the Actb mRNA level. MMP, mycoplasma pneumoniae pneumonia." ] ] ] "textoCompleto" => "IntroductionThe smallest free-living prokaryote is mycoplasma. In a pool of 16 different kinds of human mycoplasmas, 6 of them can cause disease, and the predominant pathogen is Mycoplasma pneumoniae.<a class="elsevierStyleCrossRef" href="#bib0005">1</a>Mycoplasma pneumoniae caused Mycoplasma pneumoniae pneumonia (MPP) is a common respiratory infection in children. According to statistical data, mycoplasma pneumonia accounts for 10%–40% of community acquired pneumonia (CAP) in children.<a class="elsevierStyleCrossRef" href="#bib0010">2</a> The infection rate of Mycoplasma pneumoniae in the youth has elevated, and patients with severe mycoplasma pneumonia and refractory mycoplasma pneumonia have increased.<a class="elsevierStyleCrossRef" href="#bib0015">3</a> It is currently known that Mycoplasma pneumoniae can continuously damage the respiratory epithelium and cilia through the induction of immune response, and the host cannot effectively clear the pathogen.<a class="elsevierStyleCrossRef" href="#bib0020">4</a> Severe MPP cases will give rise to numerous complications and eventually develop into a severe life-threatening pneumonia.<a class="elsevierStyleCrossRef" href="#bib0025">5</a>The human body produces a variety of inflammatory factors by activating immune cells after a Mycoplasma pneumoniae infection.<a class="elsevierStyleCrossRef" href="#bib0030">6</a> The immune response mediates and regulates immune function and inflammatory response. The inflammatory factors accumulate locally and are gradually spread from upper respiratory tract to the lower respiratory tract.<a class="elsevierStyleCrossRef" href="#bib0035">7</a> The clinical manifestations are bronchiolitis, pneumonia, etc.; in severe cases, the brain, heart, liver, and kidneys of the child may be involved, causing complications such as encephalitis, myocarditis, and hepatitis.<a class="elsevierStyleCrossRef" href="#bib0040">8</a> Research showed that tumor necrosis factor-α (TNF-α), interleukin-17 (IL-17) and IL-6 had correlation with Mycoplasma pneumoniae lung infections and MPP pathogenesis.<a class="elsevierStyleCrossRef" href="#bib0045">9</a> However, the specific molecular mechanism of MPP stimulating inflammation is unknown.In recent years, microRNA (miRNA) has been recognized by researchers as a new class of regulatory gene molecules. miRNA is a kind of evolutionarily conservative endogenous non-coding short chain small RNA. It has been shown that it can participate in the occurrence and development of various diseases. There are few reports of miRNA expression in MPP. miR-1323 is widely reported to participate in the pathogenesis of several different cancers, such as breast cancer, squamous cell carcinoma, and lung cancer.<a class="elsevierStyleCrossRefs" href="#bib0050">10–12</a> Based on our microarray analysis result, the expression of miR-1323 was depressed in children with MPP. Thus, this research aimed to investigate mirRNA-1323 expression and possible function in children with MPP.MethodsPatient characteristicsFrom March 2019 to April 2020, 26 children with MPP were recruited in this research. Exclusion criteria include current immunomodulator and immunosuppressive agent usage, recurrent pneumonia, premature delivery, and immunodeficiency. 9 children in these participants had pleural effusion, and 31 healthy children were recruited as control in the same period. Inclusion criteria of healthy control include no respiratory tract infection, no chronic infectious disease, no immune system disease history, no allergies, and no other immunity-related disease. The healthy controls have also been tested to exclude those with potential MPP infection by PCR on nasal swabs. This research was approved by the ethics committee of Cangzhou Central Hospital and corresponding informed consents were signed by all the participants’ parents or guardians.Mycoplasma pneumoniae infection was diagnosed by serologic testing and PCR from nasopharyngeal secretion. The clinical and demographic data of participants were collected through questionnaires. Peripheral blood samples were collected for laboratory examination.THP-1 cell lineThe human THP-1 cell line, derived from the peripheral blood of a 1-year-old male with acute monocytic leukaemia, was purchased from ATCC. THP-1 cells were cultured in RPMI 1640 medium (Thermo Fisher, USA), supplemented with 10% fetal bovine serum (Invitrogen, USA), 100 U/mL penicillin-streptomycin (Sigma-Aldrich, USA), and 2 mM L-glutamine with 5% CO2 at 37 °C. 0.1 μg/mL LPS (Sigma-Aldrich) was employed for stimulating THP-1 cells during the relative period.Microarray analysis of miRNAs in plasmaPlasma sample (200 μL) was mixed with Trizol (Ambion, USA) (750 μL) to isolate total RNA. Microarray hybridization, data generation and normalization were performed by the Kangchen Biological Engineering Co. Ltd. Human miRNA chip (miRCURY™, Exiqon, Denmark) with 3100 miRNA probes employed. Quantile algorithm was used for normalization. When a false discovery rate of ≤0.05 and p-value <0.05, miRNA was thought to be differentially expressed. If the expression of a miRNA had more than a two-fold difference between MPP children and healthy control, this miRNA was also thought to be differentially expressed.qRT-PCRTotal RNA of the PBMCs from the children with MPP was isolated by Trizol (Invitrogen, USA). Reverse transcription PCR was performed by the TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems, USA). qRT-PCR was performed by the TaqMan Universal PCR Master Mix kit (Applied Biosystems). Actb was used as an endogenous control. Primers used in this experiment were the following:human Il6 F: AGACAGCCACTCACCTCTTCAGhuman Il6 R: TTCTGCCAGTGCCTCTTTGCTGhuman Il17 F: CCGGACTGTGATGGTCAAhuman Il17 R: CTCATTGCGGTGGAGATThuman Tnf F: CTCTTCTGCCTGCTGCACTTTGhuman Tnf R: ATGGGCTACAGGCTTGTCACTChuman Il1b F: CCACAGACCTTCCAGGAGAATGhuman Il1b R: GTGCAGTTCAGTGATCGTACAGGhuman miR-1323 F: AAACTGAGGGGCATTTTChuman miR-1323 R: GAACATGTCTGCGTATCTChuman miR-98-5p F: GAGGTAGTAAGTTGTATTGhuman miR-98-5p R: GAACATGTCTGCGTATCTChuman miR-152-3p F: TCAGTGCATGACAGAACThuman miR-152-3p R: GAACATGTCTGCGTATCTChuman Actb F: ACGTTGCTATCCAGGCTGTGCTAThuman Actb R: TTAATGTCACGCACGATTTCCCGCStatistical analysisSPSS Statistics Version 22.0 software was employed to perform statistical analysis. Values were expressed as n (percentage, %) or mean ± SD. Data were statistically analyzed using two-sided Student's t-test and the Pearson Correlation test. The chi-square test was used for analyzing non-parametric data. p value less than 0.05 was considered to be statistically significant.ResultsParticipants characteristicsClinical and demographic data in both MPP group and control group were collected and showed in the supplementary Table S1. When compared with children the in control group, those with MPP presented longer duration of fever, enhanced neutrophils number, and elevated lactate dehydrogenase and C-reactive protein levels. The lymphocytes subgroups were also examined and the CD19+ CD23+ cell proportion was dramatically elevated in children with MPP. The concentration of Mycoplasma pneumoniae specific IgG was also increased.Altered miRNA profiles in the blood of MPP patientsThrough microarray analysis, miRNA expression in MPP patients’ blood samples were profiled and the heat map and cluster analysis are shown in <a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>. A total of 23 miRNAs had significantly altered expression in MPP patients, 15 miRNAs had enhanced expression and 8 had depressed expression. Based on the result of microarray analysis, the most down-regulated miRNAs were miR-1323, miR-98-5p, and miR-152-3p.<elsevierMultimedia ident="fig0005"></elsevierMultimedia>miR-1323 expression is significantly depressed in children with MPPTo further confirm the result of microarray analysis, the levels of miR-1323, miR-98-5p, and miR-152-3p were also evaluated through qRT-PCR. As shown in <a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>A, when compared with healthy controls, patients with MPP had dramatically lower levels of miR-1323, miR-98-5p, and miR-152-3p in blood samples. Among 26 children with MPP, 9 of them had pleural effusion. Meanwhile, compared with MPP cases lacking pleural effusion, the patients who did have pleural effusion presented lower mir-1323 and mir-98-5p levels; but mir-152-3p has no significant difference (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>B).<elsevierMultimedia ident="fig0010"></elsevierMultimedia>Il6 is the targeted gene regulated by miRNA-1323According to the Target Scan 7.1 database, Il6 mRNA is one of the direct targets of miR-1323 in the PBMCs (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>A). As shown in <a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>B, an activated inflammation response caused by MPP elevated Il17a and Il6 mRNA levels in MPP patients. Pleural effusion is an indicator and clinical manifestation of severe inflammation. Compared with children without pleural effusion, children with MPP and pleural effusion had much higher mRNA levels of Il6 and Il17a in blood samples (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>C). Through the Pearson Correlation test, the expression level of Il6 was confirmed to have a significant negative correlation with the level of miR-1323 (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>D).<elsevierMultimedia ident="fig0015"></elsevierMultimedia>miR-1323 specially regulates Il6 expression in THP-1 cellsMacrophages play a crucial role in the excessive inflammation caused by pneumonia infection. In this study, LPS stimulation in vitro was used to mimic M. pneumoniae infection, as it is well recognized that membrane lipoproteins are immuno-stimulants exerting as lipopolysaccharides (LPS) and play a crucial role in the pathogenesis of inflammatory responses upon M. pneumoniae infection.<a class="elsevierStyleCrossRefs" href="#bib0065">13,14</a> In THP-1 cells, miR-1323 expression was inhibited by the LPS treatment, with the effect of LPS enhanced by increased time of treatment (<a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>A). As shown in <a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>B, the expression of Il6, Tnf, and Il1b were all enhanced by LPS, but only Il6 expression was elevated by the inhibition of miR-1323 expression (<a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>B). A decreased level of miR-1323 was also shown in <a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>B. Meanwhile, an enhanced expression of miR-1323 declined the mRNA level of Il6 after LPS treatment but had no influence on Tnf and Il1b expression (<a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>C). An elevated level of miR-1323 was also shown in <a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>C.<elsevierMultimedia ident="fig0020"></elsevierMultimedia>DiscussionIt is currently believed that MPP is a combination of a direct pathogen invasion and immune injury. Studies demonstrate that the adhesion and proliferation of Mycoplasma pneumoniae to the host respiratory mucosal epithelial cells is the primary prerequisite for clinical symptoms.<a class="elsevierStyleCrossRef" href="#bib0075">15</a>Mycoplasma pneumoniae can firmly adhere and invade the epithelial cells to escape the body's immune mechanism or drug treatment. It can persist in the respiratory tract for several months, making the patient a chronically infected person or an asymptomatic carrier.<a class="elsevierStyleCrossRef" href="#bib0080">16</a>MPP has become a common disease in children. Due to the long course of disease and severe symptoms, it can easily cause a variety of extrapulmonary complications.<a class="elsevierStyleCrossRef" href="#bib0085">17</a> During the pathogenesis of MPP, inflammation mechanisms also play an important role.<a class="elsevierStyleCrossRef" href="#bib0030">6</a> Immune cells and cytokines dominate in immune injury, and the molecular mechanism that causes pathological changes is not very clear and is the focus of current research.Recently, studies have shown that the miRNA participates in the occurrence and development of diseases by regulating immune cell development and differentiation. In acute lung injury, the expression of multiple miRNAs in the lungs is dynamically regulated, miR-16 is up-regulated and miR-150 is down-regulated.<a class="elsevierStyleCrossRefs" href="#bib0090">18,19</a> In mice, overexpression of miR-181a promotes B lymphocyte differentiation and reduces circulating T lymphocytes.<a class="elsevierStyleCrossRef" href="#bib0100">20</a> The transformation of T cells is promoted by miR-181a, miR-146a and miR-146b, leading to a pro-inflammatory response.<a class="elsevierStyleCrossRef" href="#bib0105">21</a> miR-155 participates in regulating T helper cell differentiation and mediating T cells to participate in the immune response.<a class="elsevierStyleCrossRef" href="#bib0110">22</a> In monocytes, miR-155 responds to viruses and bacteria infection and reduces the inflammatory response.<a class="elsevierStyleCrossRef" href="#bib0115">23</a> The let-7 miRNAs inhibit the expression of IL-13 and regulate IL-13 secretion.<a class="elsevierStyleCrossRef" href="#bib0120">24</a> In inflammation caused lung damage, the miR-127 expression is down-regulated, and an enhanced miR-127 expression can inhibit the release of cytokines by macrophages.<a class="elsevierStyleCrossRef" href="#bib0125">25</a>In this study, microarray analysis found that there were differences in the expression of miRNA in the plasma of children with MPP, suggesting that miRNA may participate in the occurrence and development of MPP. There were 23 differentially expressed miRNAs in MPP children's plasma, 15 miRNAs had enhanced expression and 8 had depressed expression. The most down-regulated miRNAs were miR-1323, miR-98-5p, and miR-152-3p.It is thought that a strong inflammatory reaction in children with severe MPP can trigger a systemic inflammatory reaction and pleural effusion.<a class="elsevierStyleCrossRef" href="#bib0130">26</a> According to relevant reports, the infection rate of severe MPP with pleural effusion is as high as 50%.<a class="elsevierStyleCrossRef" href="#bib0135">27</a> For children with severe MPP and pleural effusion, cephalosporin or penicillin are often used in clinical anti-infective treatment.<a class="elsevierStyleCrossRef" href="#bib0140">28</a> In this research, among 26 children with MPP, 9 of them had pleural effusion. Levels of mir-1323 and mir-98-5p were significantly lower in MPP patients with pleural effusion than those with no pleural effusion.Research showed that IL-17, IL-6 and TNF-α are indicators commonly used in clinics to reflect inflammation.<a class="elsevierStyleCrossRef" href="#bib0145">29</a> It is widely used in infectious diseases. Altered Il17, Il6, and TNF-α expressions are important for the occurrence of Mycoplasma pneumoniae lung infection and MPP pathogenesis.<a class="elsevierStyleCrossRef" href="#bib0045">9</a> Serum IL-17 is an inflammatory mediator that has a certain effect on the immune response of cells induced by Mycoplasma pneumoniae. IL-17 has played a defensive role in the lung infection of Mycoplasma pneumoniae, which can improve the body's ability to eliminate pathogens and promote neutrophils to aggregate.<a class="elsevierStyleCrossRef" href="#bib0150">30</a> Serum IL-6 is a highly active immuno-regulatory factor that participates in pathological processes of lung inflammation. By detecting the expression of Il17 and Il6 levels in a patient's serum, the patient's condition can be accurately assessed.Compared with controls, children with MPP had lower mRNA levels of Il6 and Il17a. Compared with children without pleural effusion, children with MPP and pleural effusion had much higher mRNA levels of Il6 and Il17a. According to the Target Scan 7.1 database, Il6 is one of the direct targets of miR-1323. The expression level of Il6 also showed a significant negative correlation with the level of miR-1323.After Mycoplasma pneumoniae invades the lower respiratory tract, it stimulates epithelial cells and macrophages to release a variety of cytokines such as IL-1β, IL-4, IL-6, IL-8, IL-18, IFN-γ, activates specific and non-specific immune cells, and causes excessive immune inflammation in the pathogenesis of MPP.<a class="elsevierStyleCrossRef" href="#bib0075">15</a> In severe cases, activated macrophages can cause damage to multiple tissues and organs of the body, causing hemophagocytic syndrome. Kurai et al. found that the levels of IL-17, IL-6, TNF-α and IL-4 in the alveolar lavage fluid of Mycoplasma pneumoniae infected mice increased, aggravating the lung inflammation caused by neutrophils.<a class="elsevierStyleCrossRef" href="#bib0150">30</a>Based on these results, we used LPS to stimulate THP-1 cells and explored the expression of miR-1323, Il6 and various cytokines in LPS stimulated THP-1 cells. The expression of miR-1323 in THP-1 cells was inhibited by LPS treatment. After the administration of LPS, the expression of Il6, Tnf, and Il1b were all enhanced in THP-1 cells. However, only the expression of Il6 was inhibited by miR-1323 overexpression and promoted through the inhibition of miR-1323 expression.Cytokines play an important role in the occurrence and development of MPP, and its in-depth study is conducive in exploring the specific pathogenic mechanism of MPP. In recent years, with the increase in the incidence of MPP and with more and more severe and refractory cases, the study of its pathogenesis is conducive to an early clinical identification and effective treatment.ConclusionIn conclusion, miR-1323 targets the mRNA of Il6 and inhibits the expression of Il6. The pathogenesis of MPP inhibits the expression of miR-1323 in macrophages, triggers the overexpression if Il6 and enhances inflammation response. It should be noted that blood samples in the current study were not collected at any particular phase or stage of MPP, and it would be important to investigate the temporal expression profile of these miRNAs at different phases of the disease in the future. Also, the sample size is relatively small in this study, and more samples could be analyzed to verify the findings.FundingThe study was supported by the Cangzhou Science and Technology Research and Development Program (cz151302039).Conflict of interestThe authors declare no conflicts of interest." "textoCompletoSecciones" => array:1 [ "secciones" => array:10 [ 0 => array:3 [ "identificador" => "xres1572375" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Objective" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Method" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusion" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1416575" "titulo" => "Keywords" ] 2 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 3 => array:3 [ "identificador" => "sec0010" "titulo" => "Methods" "secciones" => array:5 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Patient characteristics" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "THP-1 cell line" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "Microarray analysis of miRNAs in plasma" ] 3 => array:2 [ "identificador" => "sec0030" "titulo" => "qRT-PCR" ] 4 => array:2 [ "identificador" => "sec0035" "titulo" => "Statistical analysis" ] ] ] 4 => array:3 [ "identificador" => "sec0040" "titulo" => "Results" "secciones" => array:5 [ 0 => array:2 [ "identificador" => "sec0045" "titulo" => "Participants characteristics" ] 1 => array:2 [ "identificador" => "sec0050" "titulo" => "Altered miRNA profiles in the blood of MPP patients" ] 2 => array:2 [ "identificador" => "sec0055" "titulo" => "miR-1323 expression is significantly depressed in children with MPP" ] 3 => array:2 [ "identificador" => "sec0060" "titulo" => "Il6 is the targeted gene regulated by miRNA-1323" ] 4 => array:2 [ "identificador" => "sec0065" "titulo" => "miR-1323 specially regulates Il6 expression in THP-1 cells" ] ] ] 5 => array:2 [ "identificador" => "sec0070" "titulo" => "Discussion" ] 6 => array:2 [ "identificador" => "sec0075" "titulo" => "Conclusion" ] 7 => array:2 [ "identificador" => "sec0080" "titulo" => "Funding" ] 8 => array:2 [ "identificador" => "sec0085" "titulo" => "Conflict of interest" ] 9 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2020-08-19" "fechaAceptado" => "2020-11-05" "PalabrasClave" => array:1 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1416575" "palabras" => array:5 [ 0 => "miR-1323" 1 => "Mycoplasma pneumonia" 2 => "MPP" 3 => "Il6" 4 => "Macrophage" ] ] ] ] "tieneResumen" => true "resumen" => array:1 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "ObjectiveMycoplasma pneumoniae pneumonia (MPP) is a common respiratory infection in children. Tumor necrosis factor-α (TNF-α), interleukin-17 (IL-17), and IL-6 have correlation with Mycoplasma pneumoniae lung infection and MPP pathogenesis. MethodmiRNAs participate in the pathogenesis of various diseases by regulating the development and differentiation of the immune cell. Blood was collected and total RNA was isolated. miRNA microarrays were performed to identify differentially expressed miRNAs in MPP patients. The levels of relative miRNAs and mRNAs were evaluated by qRT-PCR. ResultsThere are 23 differentially expressed miRNAs in MPP children's plasma, 15 miRNAs had enhanced expression and 8 had depressed expression. MPP patients showed lower mir-1323 level in blood samples than healthy controls. MPP patients with pleural effusion had much higher Il6 and Il17a mRNA levels than those without pleural effusion. The expression level of Il6 had a negative correlation with miR-1323 level. In the human THP-1 cell line, the level of miR-1323 was significantly reduced through lipopolysaccharides treatment. In THP-1 cells, overexpression or silencing of miR-1323 significantly reduced or promoted Il6 expression. ConclusionIn conclusion, miR-1323 targets the mRNA of Il6 and inhibits the expression of Il6. The pathogenesis of MPP inhibits the expression of miR-1323 in macrophages, triggers the overexpression of Il6, and enhances inflammation response." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Objective" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Method" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusion" ] ] ] ] "apendice" => array:1 [ 0 => array:1 [ "seccion" => array:1 [ 0 => array:4 [ "apendice" => "The following is Supplementary data to this article:<elsevierMultimedia ident="upi0005"></elsevierMultimedia>" "etiqueta" => "Appendix A" "titulo" => "Supplementary data" "identificador" => "sec0095" ] ] ] ] "multimedia" => array:5 [ 0 => array:8 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1233 "Ancho" => 1508 "Tamanyo" => 215778 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0005" "detalle" => "Figure " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Total miRNAs profiling from microarray analysis. Heat map and cluster analysis of miRNA expression. Individual patient samples are shown in columns and miRNAs. Individual patient samples are shown in columns and miRNAs in rows. Of all differentially expressed miRNAs, 15 miRNAs were up-regulated and 8 miRNAs down-regulated. MMP, mycoplasma pneumoniae pneumonia." ] ] 1 => array:8 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 2289 "Ancho" => 2925 "Tamanyo" => 373044 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0010" "detalle" => "Figure " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Comparisons of multiple miRNA between MPP cases and healthy controls. a, Levels of miRNAs in in the PBMCs from the MPP patients and healthy controls; b, Levels of miRNAs in MPP patients with pleura effusion and MPP patients without pleura effusion. Error bars indicate standard error. All qRT-PCR data are presented as the fold induction relative to the Actb mRNA level. MMP, mycoplasma pneumoniae pneumonia." ] ] 2 => array:8 [ "identificador" => "fig0015" "etiqueta" => "Figure 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 1254 "Ancho" => 3008 "Tamanyo" => 311162 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0015" "detalle" => "Figure " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "Il6 is the targeted gene regulated by miRNA-1323. a, The binding site of miR-1323 in the Il6 mRNA; b, Expression of Il6 and Il17a in the PBMCs from the children with MPP; c, Expression of Il6 and Il17a in MPP cases with and without pleural effusion; d, Correlation between the concentration of Il6 and miR-1323. All qRT-PCR data are presented as the fold induction relative to the Actb mRNA level. MMP, mycoplasma pneumoniae pneumonia." ] ] 3 => array:8 [ "identificador" => "fig0020" "etiqueta" => "Figure 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 1121 "Ancho" => 3008 "Tamanyo" => 166486 ] ] "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at0020" "detalle" => "Figure " "rol" => "short" ] ] "descripcion" => array:1 [ "en" => "miR-1323 specially regulates Il6 expression in THP-1 cells. a, Level of miR-1323 in THP-1 cells treated by LPS; b, THP-1 cells were treated by anti-miR-1323 oligo, mRNA levels of Il6, Tnf, Il1b, and miR-1323 were measure by qRT-PCR; c, miR-1323 was overexpressed in THP-1 cells, mRNA levels of Il6, Tnf, Il1b, and miR-1323 were measured by qRT-PCR. All qRT-PCR data are presented as the fold induction relative to the Actb mRNA level. MMP, mycoplasma pneumoniae pneumonia; LPS, lipopolysaccharide." ] ] 4 => array:5 [ "identificador" => "upi0005" "tipo" => "MULTIMEDIAECOMPONENTE" "mostrarFloat" => false "mostrarDisplay" => true "Ecomponente" => array:2 [ "fichero" => "mmc1.docx" "ficheroTamanyo" => 17012 ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0005" "bibliografiaReferencia" => array:30 [ 0 => array:3 [ "identificador" => "bib0005" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "In vitro susceptibilities to and bactericidal activities of garenoxacin (BMS-284756) and other antimicrobial agents against human mycoplasmas and ureaplasmas" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "K.B. Waites" 1 => "D.M. Crabb" 2 => "X. Bing" 3 => "L.B. Duffy" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Antimicrob Agents Chemother." "fecha" => "2003" "volumen" => "47" "paginaInicial" => "161" "paginaFinal" => "165" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0010" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Difference of clinical features in childhood Mycoplasma pneumoniae pneumonia" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y.S. Youn" 1 => "K.Y. Lee" 2 => "J.Y. Hwang" 3 => "J.W. Rhim" 4 => "J.H. Kang" 5 => "J.S. Lee" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/1471-2431-10-48" "Revista" => array:5 [ "tituloSerie" => "BMC Pediatr." "fecha" => "2010" "volumen" => "10" "paginaInicial" => "48" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20604923" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0015" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The clinical characteristics of corticosteroid-resistant refractory Mycoplasma Pneumoniae pneumonia in children" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "Y. Yan" 1 => "Y. Wei" 2 => "W. Jiang" 3 => "C. Hao" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Sci Rep." "fecha" => "2016" "volumen" => "6" "paginaInicial" => "39929" ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0020" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Clinical features and treatment of macrolide-resistant Mycoplasma pneumoniae pneumonia in children" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y. Chen" 1 => "W.M. Tian" 2 => "Q. Chen" 3 => "H.Y. Zhao" 4 => "P. Huang" 5 => "Z.Q. Lin" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Zhongguo Dang Dai Er Ke Za Zhi." "fecha" => "2018" "volumen" => "20" "paginaInicial" => "629" "paginaFinal" => "634" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30111471" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0025" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Severe acute lung injury caused by Mycoplasma pneumoniae: potential role for steroid pulses in treatment" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "M. Radisic" 1 => "A. Torn" 2 => "P. Gutierrez" 3 => "H.A. Defranchi" 4 => "P. Pardo" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1086/317498" "Revista" => array:6 [ "tituloSerie" => "Clin Infect Dis." "fecha" => "2000" "volumen" => "31" "paginaInicial" => "1507" "paginaFinal" => "1511" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11096025" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0030" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Inflammation-inducing Factors of Mycoplasma pneumoniae" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "T. Shimizu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3389/fmicb.2016.00414" "Revista" => array:5 [ "tituloSerie" => "Front Microbiol." "fecha" => "2016" "volumen" => "7" "paginaInicial" => "414" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27065977" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0035" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Pathogenesis of Mycoplasma pneumoniae: an update" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "R. Chaudhry" 1 => "A. Ghosh" 2 => "A. Chandolia" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.4103/0255-0857.174112" "Revista" => array:6 [ "tituloSerie" => "Indian J Med Microbiol." "fecha" => "2016" "volumen" => "34" "paginaInicial" => "7" "paginaFinal" => "16" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26776112" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0040" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Extra-pulmonary manifestations associated with Mycoplasma pneumoniae pneumonia in adults" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "Y. Kawai" 1 => "N. Miyashita" 2 => "T. Kato" 3 => "N. Okimoto" 4 => "M. Narita" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.ejim.2015.11.011" "Revista" => array:7 [ "tituloSerie" => "Eur J Intern Med." "fecha" => "2016" "volumen" => "29" "paginaInicial" => "e9" "paginaFinal" => "e10" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26621759" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0049017218303317" "estado" => "S300" "issn" => "00490172" ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0045" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Distribution and expression of IL-17 and related cytokines in children with Mycoplasma pneumoniae Pneumonia" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "H. Fan" 1 => "B. Lu" 2 => "D. Yang" 3 => "D. Zhang" 4 => "T. Shi" 5 => "G. Lu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.7883/yoken.JJID.2019.113" "Revista" => array:6 [ "tituloSerie" => "Jpn J Infect Dis." "fecha" => "2019" "volumen" => "72" "paginaInicial" => "387" "paginaFinal" => "393" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31257245" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0050" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "LncRNA GAS5-mediated miR-1323 promotes tumor progression by targeting TP53INP1 in hepatocellular carcinoma" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "F. Zhang" 1 => "C. Yang" 2 => "Z. Xing" 3 => "P. Liu" 4 => "B. Zhang" 5 => "X. Ma" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2147/OTT.S209439" "Revista" => array:6 [ "tituloSerie" => "Onco Targets Ther." "fecha" => "2019" "volumen" => "12" "paginaInicial" => "4013" "paginaFinal" => "4023" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31190897" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0055" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MicroRNA-1323 downregulation promotes migration and invasion of breast cancer cells by targeting tumour protein D52" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "Y. Xu" 1 => "M. Liu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/jb/mvaa035" "Revista" => array:7 [ "tituloSerie" => "J Biochem." "fecha" => "2020" "volumen" => "168" "paginaInicial" => "83" "paginaFinal" => "91" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32211853" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0002870318302928" "estado" => "S300" "issn" => "00028703" ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0060" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MicroRNA expression profiling for the prediction of resistance to neoadjuvant radiochemotherapy in squamous cell carcinoma of the esophagus" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J. Slotta-Huspenina" 1 => "E. Drecoll" 2 => "M. Feith" 3 => "D. Habermehl" 4 => "S. Combs" 5 => "W. Weichert" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s12967-018-1492-9" "Revista" => array:5 [ "tituloSerie" => "J Transl Med." "fecha" => "2018" "volumen" => "16" "paginaInicial" => "109" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29695253" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0065" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Mycoplasma pneumoniae lipids license TLR-4 for activation of NLRP3 inflammasome and autophagy to evoke a proinflammatory response" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "H. Luo" 1 => "J. He" 2 => "L. Qin" 3 => "Y. Chen" 4 => "L. Chen" 5 => "R. Li" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/cei.13510" "Revista" => array:2 [ "tituloSerie" => "Clin Exp Immunol." "fecha" => "2020" ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0070" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Mycoplasma pneumoniae-derived lipopeptides induce acute inflammatory responses in the lungs of mice" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "T. Shimizu" 1 => "Y. Kida" 2 => "K. Kuwano" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/IAI.00955-07" "Revista" => array:6 [ "tituloSerie" => "Infect Immun." "fecha" => "2008" "volumen" => "76" "paginaInicial" => "270" "paginaFinal" => "277" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17954722" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0075" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hyperoside inhibits proinflammatory cytokines in human lung epithelial cells infected with Mycoplasma pneumoniae" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "F. Liu" 1 => "Y. Zhao" 2 => "J. Lu" 3 => "S. Chen" 4 => "X. Zhang" 5 => "W. Mao" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Mol Cell Biochem." "fecha" => "2019" "volumen" => "453" "paginaInicial" => "179" "paginaFinal" => "186" ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0080" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Release of cytokines by human nasal epithelial cells and peripheral blood mononuclear cells infected with Mycoplasma pneumoniae" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "M.Y. Kazachkov" 1 => "P.C. Hu" 2 => "J.L. Carson" 3 => "P.C. Murphy" 4 => "F.W. Henderson" 5 => "T.L. Noah" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1177/153537020222700505" "Revista" => array:6 [ "tituloSerie" => "Exp Biol Med (Maywood)." "fecha" => "2002" "volumen" => "227" "paginaInicial" => "330" "paginaFinal" => "335" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11976403" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0085" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Extra-pulmonary diseases related to Mycoplasma pneumoniae in children: recent insights into the pathogenesis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "D. Poddighe" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1097/BOR.0000000000000494" "Revista" => array:7 [ "tituloSerie" => "Curr Opin Rheumatol." "fecha" => "2018" "volumen" => "30" "paginaInicial" => "380" "paginaFinal" => "387" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29432224" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0140673604176708" "estado" => "S300" "issn" => "01406736" ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0090" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "miR-16 inhibits NLRP3 inflammasome activation by directly targeting TLR4 in acute lung injury" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y. Yang" 1 => "F. Yang" 2 => "X. Yu" 3 => "B. Wang" 4 => "Y. Yang" 5 => "X. Zhou" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:3 [ "tituloSerie" => "Biomed Pharmacother." "fecha" => "2019" "volumen" => "112" ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0095" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MiR-150 attenuates LPS-induced acute lung injury via targeting AKT3" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "P. Li" 1 => "Y. Yao" 2 => "Y. Ma" 3 => "Y. Chen" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:3 [ "tituloSerie" => "Int Immunopharmacol." "fecha" => "2019" "volumen" => "75" ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0100" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "miR-181a negatively regulates NF-κB signaling and affects activated B-cell-like diffuse large B-cell lymphoma pathogenesis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "G.A. Kozloski" 1 => "X. Jiang" 2 => "S. Bhatt" 3 => "J. Ruiz" 4 => "F. Vega" 5 => "R. Shaknovich" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Blood." "fecha" => "2016" "volumen" => "127" "paginaInicial" => "2856" "paginaFinal" => "2866" ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0105" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Altered expression of miR-181a and miR-146a does not change the expression of surface NCRs in human NK cells" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "M. Rady" 1 => "C. Watzl" 2 => "M. Claus" 3 => "O. Khorshid" 4 => "L. Mahran" 5 => "K. Abou-Aisha" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Sci Rep." "fecha" => "2017" "volumen" => "7" "paginaInicial" => "41381" ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0110" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Increased Levels of miR-155 are Related to Higher T-Cell Activation in the Peripheral Blood of Patients with Chronic Hepatitis B" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "J. Fang" 1 => "L. Zhuge" 2 => "H. Rao" 3 => "S. Huang" 4 => "L. Jin" 5 => "J. Li" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1089/gtmb.2018.0092" "Revista" => array:6 [ "tituloSerie" => "Genet Test Mol Biomarkers." "fecha" => "2019" "volumen" => "23" "paginaInicial" => "118" "paginaFinal" => "123" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30735455" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0115" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MiR-155 enhances phagocytic activity of β-thalassemia/HbE monocytes via targeting of BACH1" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "K. Srinoun" 1 => "C. Nopparatana" 2 => "M. Wongchanchailert" 3 => "S. Fucharoen" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s12185-017-2291-4" "Revista" => array:6 [ "tituloSerie" => "Int J Hematol." "fecha" => "2017" "volumen" => "106" "paginaInicial" => "638" "paginaFinal" => "647" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28685309" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0120" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Let-7 microRNA-mediated regulation of IL-13 and allergic airway inflammation" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Kumar" 1 => "T. Ahmad" 2 => "A. Sharma" 3 => "U. Mabalirajan" 4 => "A. Kulshreshtha" 5 => "A. Agrawal" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jaci.2011.05.025" "Revista" => array:4 [ "tituloSerie" => "J Allergy Clin Immunol." "fecha" => "2011" "volumen" => "128" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21745684" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0125" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "MiR-127 modulates macrophage polarization and promotes lung inflammation and injury by activating the JNK pathway" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "H. Ying" 1 => "Y. Kang" 2 => "H. Zhang" 3 => "D. Zhao" 4 => "J. Xia" 5 => "Z. Lu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.4049/jimmunol.1402088" "Revista" => array:6 [ "tituloSerie" => "J Immunol." "fecha" => "2015" "volumen" => "194" "paginaInicial" => "1239" "paginaFinal" => "1251" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25520401" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0130" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Mycoplasma pneumoniae Pneumonia with Worsening Pleural Effusion Despite Treatment with Appropriate Antimicrobials: Case report" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "K.S. Hassan" 1 => "G. Al-Khadouri" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.18295/squmj.2018.18.02.022" "Revista" => array:6 [ "tituloSerie" => "Sultan Qaboos Univ Med J." "fecha" => "2018" "volumen" => "18" "paginaInicial" => "e239" "paginaFinal" => "e242" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30210860" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0135" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Clinical relevance and characteristics of pleural effusion in patients with Mycoplasma pneumoniae pneumonia" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S.I. Cha" 1 => "K.M. Shin" 2 => "K.N. Jeon" 3 => "S.S. Yoo" 4 => "J. Lee" 5 => "S.Y. Lee" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Scand J Infect Dis." "fecha" => "2012" "volumen" => "44" "paginaInicial" => "793" "paginaFinal" => "797" ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0140" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Molecular and clinical characteristics of severe Mycoplasma pneumoniae pneumonia in children" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "C. Yan" 1 => "G. Xue" 2 => "H. Zhao" 3 => "Y. Feng" 4 => "S. Li" 5 => "J. Cui" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/ppul.24327" "Revista" => array:7 [ "tituloSerie" => "Pediatr Pulmonol." "fecha" => "2019" "volumen" => "54" "paginaInicial" => "1012" "paginaFinal" => "1021" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31119869" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0895435618306668" "estado" => "S300" "issn" => "08954356" ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0145" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The Physiological functions of IKK-selective substrate identification and their critical roles in diseases" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "J.-S. Yu" 1 => "J. Jin" 2 => "Y.-y. Li" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "STEMedicine." "fecha" => "2020" "volumen" => "1" "paginaInicial" => "e49" ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0150" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Mycoplasma pneumoniae extract induces an IL-17-associated inflammatory reaction in murine lung: implication for mycoplasmal pneumonia" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "D. Kurai" 1 => "K. Nakagaki" 2 => "H. Wada" 3 => "T. Saraya" 4 => "S. Kamiya" 5 => "Y. Fujioka" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s10753-012-9545-3" "Revista" => array:6 [ "tituloSerie" => "Inflammation." "fecha" => "2013" "volumen" => "36" "paginaInicial" => "285" "paginaFinal" => "293" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23001692" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/00217557/0000009700000005/v1_202109160616/S0021755720302515/v1_202109160616/en/main.assets" "Apartado" => array:4 [ "identificador" => "10179" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original articles" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/00217557/0000009700000005/v1_202109160616/S0021755720302515/v1_202109160616/en/main.pdf?idApp=UINPBA000049&text.app=https://jped.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0021755720302515?idApp=UINPBA000049"]

Statistics

Original article

Linlin Yina,

Corresponding author

Yinlinlin818@163.com

Corresponding author.

, Yajun Mab, Wenlong Wanga, Yitang Zhua

a Cangzhou Central Hospital, Department of Clinical Laboratory, Hebei, China

b Tengzhou Central People’s Hospital, Department of Clinical Laboratory, Shandong, China

Read

2239

Times
was read the article

1134

Total PDF

1105

Total HTML

Share statistics

 array:24 [
  "pii" => "S0021755720302515"
  "issn" => "00217557"
  "doi" => "10.1016/j.jped.2020.11.004"
  "estado" => "S300"
  "fechaPublicacion" => "2021-09-01"
  "aid" => "951"
  "copyright" => "Sociedade Brasileira de Pediatria"
  "copyrightAnyo" => "2020"
  "documento" => "article"
  "crossmark" => 1
  "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
  "subdocumento" => "fla"
  "cita" => "J Pediatr &#40;Rio J&#41;. 2021;97:552-8"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:1 [
    "total" => 0
  ]
  "itemSiguiente" => array:18 [
    "pii" => "S0021755720302527"
    "issn" => "00217557"
    "doi" => "10.1016/j.jped.2020.11.005"
    "estado" => "S300"
    "fechaPublicacion" => "2021-09-01"
    "aid" => "952"
    "documento" => "article"
    "crossmark" => 1
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "J Pediatr &#40;Rio J&#41;. 2021;97:559-63"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Accuracy of neck circumference for diagnosing overweight in six- and seven-year-old children"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "559"
          "paginaFinal" => "563"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0010"
          "etiqueta" => "Figure 2"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr2.jpeg"
              "Alto" => 1235
              "Ancho" => 2508
              "Tamanyo" => 178493
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "at0010"
              "detalle" => "Figure "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">ROC curves of the neck circumference as a predictor of obesity for the general population &#40;A&#41;&#44; male &#40;B&#41; and female &#40;C&#41;&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Eduarda Mucelin, Jefferson Traebert, Milcia Almeida Zaidan, Anna Paula Piovezan, Rodrigo Dias Nunes, Eliane Traebert"
          "autores" => array:6 [
            0 => array:2 [
              "nombre" => "Eduarda"
              "apellidos" => "Mucelin"
            ]
            1 => array:2 [
              "nombre" => "Jefferson"
              "apellidos" => "Traebert"
            ]
            2 => array:2 [
              "nombre" => "Milcia Almeida"
              "apellidos" => "Zaidan"
            ]
            3 => array:2 [
              "nombre" => "Anna Paula"
              "apellidos" => "Piovezan"
            ]
            4 => array:2 [
              "nombre" => "Rodrigo Dias"
              "apellidos" => "Nunes"
            ]
            5 => array:2 [
              "nombre" => "Eliane"
              "apellidos" => "Traebert"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0021755720302527?idApp=UINPBA000049"
    "url" => "/00217557/0000009700000005/v1_202109160616/S0021755720302527/v1_202109160616/en/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S0021755720302564"
    "issn" => "00217557"
    "doi" => "10.1016/j.jped.2020.11.008"
    "estado" => "S300"
    "fechaPublicacion" => "2021-09-01"
    "aid" => "956"
    "copyright" => "Sociedade Brasileira de Pediatria"
    "documento" => "article"
    "crossmark" => 1
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "J Pediatr &#40;Rio J&#41;. 2021;97:546-51"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:12 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Association between interleukin-10 polymorphisms and CD4<span class="elsevierStyleSup">&#43;</span>CD25<span class="elsevierStyleSup">&#43;</span>FOXP3<span class="elsevierStyleSup">&#43;</span> T cells in asthmatic children"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => "en"
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "546"
          "paginaFinal" => "551"
        ]
      ]
      "contieneResumen" => array:1 [
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:8 [
          "identificador" => "fig0005"
          "etiqueta" => "Figure 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 988
              "Ancho" => 2925
              "Tamanyo" => 171163
            ]
          ]
          "detalles" => array:1 [
            0 => array:3 [
              "identificador" => "at0005"
              "detalle" => "Figure "
              "rol" => "short"
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Association between IL-10 gene SNP rs3024491 and levels of IL-10 protein &#40;a&#41;&#44; asthma severity &#40;b&#41; and Tregs cells frequency &#40;c&#41;&#46;</p> <p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">GG genotype&#44; TG genotype&#44; TT genotype&#59; SNP&#44; single nucleotide polymorphism&#59; Tregs&#44; regulatory T cells&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Mag&#225;li Mocellin, Lidiane Alves de Azeredo Leit&#227;o, Patr&#237;cia Dias de Ara&#250;jo, Marcus Herbert Jones, Renato Tetelbom Stein, Paulo M&#225;rcio Pitrez, Ana Paula Duarte de Souza, Leonardo Ara&#250;jo Pinto"
          "autores" => array:8 [
            0 => array:2 [
              "nombre" => "Mag&#225;li"
              "apellidos" => "Mocellin"
            ]
            1 => array:2 [
              "nombre" => "Lidiane Alves"
              "apellidos" => "de Azeredo Leit&#227;o"
            ]
            2 => array:2 [
              "nombre" => "Patr&#237;cia Dias"
              "apellidos" => "de Ara&#250;jo"
            ]
            3 => array:2 [
              "nombre" => "Marcus Herbert"
              "apellidos" => "Jones"
            ]
            4 => array:2 [
              "nombre" => "Renato Tetelbom"
              "apellidos" => "Stein"
            ]
            5 => array:2 [
              "nombre" => "Paulo M&#225;rcio"
              "apellidos" => "Pitrez"
            ]
            6 => array:2 [
              "nombre" => "Ana Paula Duarte"
              "apellidos" => "de Souza"
            ]
            7 => array:2 [
              "nombre" => "Leonardo Ara&#250;jo"
              "apellidos" => "Pinto"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0021755720302564?idApp=UINPBA000049"
    "url" => "/00217557/0000009700000005/v1_202109160616/S0021755720302564/v1_202109160616/en/main.assets"
  ]
  "en" => array:19 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
    "titulo" => "The critical function of miR-1323&#47;Il6 axis in children with <span class="elsevierStyleItalic">Mycoplasma pneumoniae</span> pneumonia"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "552"
        "paginaFinal" => "558"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Linlin Yin, Yajun Ma, Wenlong Wang, Yitang Zhu"
        "autores" => array:4 [
          0 => array:4 [
            "nombre" => "Linlin"
            "apellidos" => "Yin"
            "email" => array:1 [
              0 => "Yinlinlin818@163.com"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "&#42;"
                "identificador" => "cor0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Yajun"
            "apellidos" => "Ma"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Wenlong"
            "apellidos" => "Wang"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "Yitang"
            "apellidos" => "Zhu"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:2 [
          0 => array:3 [
            "entidad" => "Cangzhou Central Hospital&#44; Department of Clinical Laboratory&#44; Hebei&#44; China"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Tengzhou Central People&#8217;s Hospital&#44; Department of Clinical Laboratory&#44; Shandong&#44; China"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46;"
          ]
        ]
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:8 [
        "identificador" => "fig0010"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 2289
            "Ancho" => 2925
            "Tamanyo" => 373044
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0010"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Comparisons of multiple miRNA between MPP cases and healthy controls&#46;</p> <p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">a&#44; Levels of miRNAs in in the PBMCs from the MPP patients and healthy controls&#59; b&#44; Levels of miRNAs in MPP patients with pleura effusion and MPP patients without pleura effusion&#46; Error bars indicate standard error&#46; All qRT-PCR data are presented as the fold induction relative to the <span class="elsevierStyleItalic">Actb</span> mRNA level&#46;</p> <p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">MMP&#44; mycoplasma pneumoniae pneumonia&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">The smallest free-living prokaryote is mycoplasma&#46; In a pool of 16 different kinds of human mycoplasmas&#44; 6 of them can cause disease&#44; and the predominant pathogen is <span class="elsevierStyleItalic">Mycoplasma pneumoniae</span>&#46;<a class="elsevierStyleCrossRef" href="#bib0005"><span class="elsevierStyleSup">1</span></a><span class="elsevierStyleItalic">Mycoplasma pneumoniae</span> caused <span class="elsevierStyleItalic">Mycoplasma pneumoniae</span> pneumonia &#40;MPP&#41; is a common respiratory infection in children&#46; According to statistical data&#44; mycoplasma pneumonia accounts for 10&#37;&#8211;40&#37; of community acquired pneumonia &#40;CAP&#41; in children&#46;<a class="elsevierStyleCrossRef" href="#bib0010"><span class="elsevierStyleSup">2</span></a> The infection rate of <span class="elsevierStyleItalic">Mycoplasma pneumoniae</span> in the youth has elevated&#44; and patients with severe mycoplasma pneumonia and refractory mycoplasma pneumonia have increased&#46;<a class="elsevierStyleCrossRef" href="#bib0015"><span class="elsevierStyleSup">3</span></a> It is currently known that <span class="elsevierStyleItalic">Mycoplasma pneumoniae</span> can continuously damage the respiratory epithelium and cilia through the induction of immune response&#44; and the host cannot effectively clear the pathogen&#46;<a class="elsevierStyleCrossRef" href="#bib0020"><span class="elsevierStyleSup">4</span></a> Severe MPP cases will give rise to numerous complications and eventually develop into a severe life-threatening pneumonia&#46;<a class="elsevierStyleCrossRef" href="#bib0025"><span class="elsevierStyleSup">5</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">The human body produces a variety of inflammatory factors by activating immune cells after a <span class="elsevierStyleItalic">Mycoplasma pneumoniae</span> infection&#46;<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a> The immune response mediates and regulates immune function and inflammatory response&#46; The inflammatory factors accumulate locally and are gradually spread from upper respiratory tract to the lower respiratory tract&#46;<a class="elsevierStyleCrossRef" href="#bib0035"><span class="elsevierStyleSup">7</span></a> The clinical manifestations are bronchiolitis&#44; pneumonia&#44; etc&#46;&#59; in severe cases&#44; the brain&#44; heart&#44; liver&#44; and kidneys of the child may be involved&#44; causing complications such as encephalitis&#44; myocarditis&#44; and hepatitis&#46;<a class="elsevierStyleCrossRef" href="#bib0040"><span class="elsevierStyleSup">8</span></a> Research showed that tumor necrosis factor-&#945; &#40;TNF-&#945;&#41;&#44; interleukin-17 &#40;IL-17&#41; and IL-6 had correlation with <span class="elsevierStyleItalic">Mycoplasma pneumoniae</span> lung infections and MPP pathogenesis&#46;<a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a> However&#44; the specific molecular mechanism of MPP stimulating inflammation is unknown&#46;</p><p id="par0015" class="elsevierStylePara elsevierViewall">In recent years&#44; microRNA &#40;miRNA&#41; has been recognized by researchers as a new class of regulatory gene molecules&#46; miRNA is a kind of evolutionarily conservative endogenous non-coding short chain small RNA&#46; It has been shown that it can participate in the occurrence and development of various diseases&#46; There are few reports of miRNA expression in MPP&#46; miR-1323 is widely reported to participate in the pathogenesis of several different cancers&#44; such as breast cancer&#44; squamous cell carcinoma&#44; and lung cancer&#46;<a class="elsevierStyleCrossRefs" href="#bib0050"><span class="elsevierStyleSup">10&#8211;12</span></a> Based on our microarray analysis result&#44; the expression of miR-1323 was depressed in children with MPP&#46; Thus&#44; this research aimed to investigate mirRNA-1323 expression and possible function in children with MPP&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Patient characteristics</span><p id="par0020" class="elsevierStylePara elsevierViewall">From March 2019 to April 2020&#44; 26 children with MPP were recruited in this research&#46; Exclusion criteria include current immunomodulator and immunosuppressive agent usage&#44; recurrent pneumonia&#44; premature delivery&#44; and immunodeficiency&#46; 9 children in these participants had pleural effusion&#44; and 31 healthy children were recruited as control in the same period&#46; Inclusion criteria of healthy control include no respiratory tract infection&#44; no chronic infectious disease&#44; no immune system disease history&#44; no allergies&#44; and no other immunity-related disease&#46; The healthy controls have also been tested to exclude those with potential MPP infection by PCR on nasal swabs&#46; This research was approved by the ethics committee of Cangzhou Central Hospital and corresponding informed consents were signed by all the participants&#8217; parents or guardians&#46;</p><p id="par0025" class="elsevierStylePara elsevierViewall"><span class="elsevierStyleItalic">Mycoplasma pneumoniae</span> infection was diagnosed by serologic testing and PCR from nasopharyngeal secretion&#46; The clinical and demographic data of participants were collected through questionnaires&#46; Peripheral blood samples were collected for laboratory examination&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">THP-1 cell line</span><p id="par0030" class="elsevierStylePara elsevierViewall">The human THP-1 cell line&#44; derived from the peripheral blood of a 1-year-old male with acute monocytic leukaemia&#44; was purchased from ATCC&#46; THP-1 cells were cultured in RPMI 1640 medium &#40;Thermo Fisher&#44; USA&#41;&#44; supplemented with 10&#37; fetal bovine serum &#40;Invitrogen&#44; USA&#41;&#44; 100 U&#47;mL penicillin-streptomycin &#40;Sigma-Aldrich&#44; USA&#41;&#44; and 2&#8239;mM L-glutamine with 5&#37; CO<span class="elsevierStyleInf">2</span> at 37&#8239;&#176;C&#46; 0&#46;1&#8239;&#956;g&#47;mL LPS &#40;Sigma-Aldrich&#41; was employed for stimulating THP-1 cells during the relative period&#46;</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0055">Microarray analysis of miRNAs in plasma</span><p id="par0035" class="elsevierStylePara elsevierViewall">Plasma sample &#40;200&#8239;&#956;L&#41; was mixed with Trizol &#40;Ambion&#44; USA&#41; &#40;750&#8239;&#956;L&#41; to isolate total RNA&#46; Microarray hybridization&#44; data generation and normalization were performed by the Kangchen Biological Engineering Co&#46; Ltd&#46; Human miRNA chip &#40;miRCURY&#8482;&#44; Exiqon&#44; Denmark&#41; with 3100 miRNA probes employed&#46; Quantile algorithm was used for normalization&#46; When a false discovery rate of &#8804;0&#46;05 and p-value &#60;0&#46;05&#44; miRNA was thought to be differentially expressed&#46; If the expression of a miRNA had more than a two-fold difference between MPP children and healthy control&#44; this miRNA was also thought to be differentially expressed&#46;</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0060">qRT-PCR</span><p id="par0040" class="elsevierStylePara elsevierViewall">Total RNA of the PBMCs from the children with MPP was isolated by Trizol &#40;Invitrogen&#44; USA&#41;&#46; Reverse transcription PCR was performed by the TaqMan MicroRNA Reverse Transcription kit &#40;Applied Biosystems&#44; USA&#41;&#46; qRT-PCR was performed by the TaqMan Universal PCR Master Mix kit &#40;Applied Biosystems&#41;&#46; <span class="elsevierStyleItalic">Actb</span> was used as an endogenous control&#46; Primers used in this experiment were the following&#58;</p><p id="par0045" class="elsevierStylePara elsevierViewall">human <span class="elsevierStyleItalic">Il6</span> F&#58; AGACAGCCACTCACCTCTTCAG</p><p id="par0050" class="elsevierStylePara elsevierViewall">human <span class="elsevierStyleItalic">Il6</span> R&#58; TTCTGCCAGTGCCTCTTTGCTG</p><p id="par0055" class="elsevierStylePara elsevierViewall">human <span class="elsevierStyleItalic">Il17</span> F&#58; CCGGACTGTGATGGTCAA</p><p id="par0060" class="elsevierStylePara elsevierViewall">human <span class="elsevierStyleItalic">Il17</span> R&#58; CTCATTGCGGTGGAGATT</p><p id="par0065" class="elsevierStylePara elsevierViewall">human <span class="elsevierStyleItalic">Tnf</span> F&#58; CTCTTCTGCCTGCTGCACTTTG</p><p id="par0070" class="elsevierStylePara elsevierViewall">human <span class="elsevierStyleItalic">Tnf</span> R&#58; ATGGGCTACAGGCTTGTCACTC</p><p id="par0075" class="elsevierStylePara elsevierViewall">human <span class="elsevierStyleItalic">Il1b</span> F&#58; CCACAGACCTTCCAGGAGAATG</p><p id="par0080" class="elsevierStylePara elsevierViewall">human <span class="elsevierStyleItalic">Il1b</span> R&#58; GTGCAGTTCAGTGATCGTACAGG</p><p id="par0085" class="elsevierStylePara elsevierViewall">human miR-1323 F&#58; AAACTGAGGGGCATTTTC</p><p id="par0090" class="elsevierStylePara elsevierViewall">human miR-1323 R&#58; GAACATGTCTGCGTATCTC</p><p id="par0095" class="elsevierStylePara elsevierViewall">human miR-98-5p F&#58; GAGGTAGTAAGTTGTATTG</p><p id="par0100" class="elsevierStylePara elsevierViewall">human miR-98-5p R&#58; GAACATGTCTGCGTATCTC</p><p id="par0105" class="elsevierStylePara elsevierViewall">human miR-152-3p F&#58; TCAGTGCATGACAGAACT</p><p id="par0110" class="elsevierStylePara elsevierViewall">human miR-152-3p R&#58; GAACATGTCTGCGTATCTC</p><p id="par0115" class="elsevierStylePara elsevierViewall">human <span class="elsevierStyleItalic">Actb</span> F&#58; ACGTTGCTATCCAGGCTGTGCTAT</p><p id="par0120" class="elsevierStylePara elsevierViewall">human <span class="elsevierStyleItalic">Actb</span> R&#58; TTAATGTCACGCACGATTTCCCGC</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Statistical analysis</span><p id="par0125" class="elsevierStylePara elsevierViewall">SPSS Statistics Version 22&#46;0 software was employed to perform statistical analysis&#46; Values were expressed as n &#40;percentage&#44; &#37;&#41; or mean&#8239;&#177;&#8239;SD&#46; Data were statistically analyzed using two-sided Student&#39;s <span class="elsevierStyleItalic">t</span>-test and the Pearson Correlation test&#46; The chi-square test was used for analyzing non-parametric data&#46; p value less than 0&#46;05 was considered to be statistically significant&#46;</p></span></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Results</span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Participants characteristics</span><p id="par0130" class="elsevierStylePara elsevierViewall">Clinical and demographic data in both MPP group and control group were collected and showed in the supplementary Table S1&#46; When compared with children the in control group&#44; those with MPP presented longer duration of fever&#44; enhanced neutrophils number&#44; and elevated lactate dehydrogenase and C-reactive protein levels&#46; The lymphocytes subgroups were also examined and the CD19&#43; CD23&#43; cell proportion was dramatically elevated in children with MPP&#46; The concentration of <span class="elsevierStyleItalic">Mycoplasma pneumoniae</span> specific IgG was also increased&#46;</p></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Altered miRNA profiles in the blood of MPP patients</span><p id="par0135" class="elsevierStylePara elsevierViewall">Through microarray analysis&#44; miRNA expression in MPP patients&#8217; blood samples were profiled and the heat map and cluster analysis are shown in <a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>&#46; A total of 23 miRNAs had significantly altered expression in MPP patients&#44; 15 miRNAs had enhanced expression and 8 had depressed expression&#46; Based on the result of microarray analysis&#44; the most down-regulated miRNAs were miR-1323&#44; miR-98-5p&#44; and miR-152-3p&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">miR-1323 expression is significantly depressed in children with MPP</span><p id="par0140" class="elsevierStylePara elsevierViewall">To further confirm the result of microarray analysis&#44; the levels of miR-1323&#44; miR-98-5p&#44; and miR-152-3p were also evaluated through qRT-PCR&#46; As shown in <a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>A&#44; when compared with healthy controls&#44; patients with MPP had dramatically lower levels of miR-1323&#44; miR-98-5p&#44; and miR-152-3p in blood samples&#46; Among 26 children with MPP&#44; 9 of them had pleural effusion&#46; Meanwhile&#44; compared with MPP cases lacking pleural effusion&#44; the patients who did have pleural effusion presented lower mir-1323 and mir-98-5p levels&#59; but mir-152-3p has no significant difference &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>B&#41;&#46;</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Il6 is the targeted gene regulated by miRNA-1323</span><p id="par0145" class="elsevierStylePara elsevierViewall">According to the Target Scan 7&#46;1 database&#44; <span class="elsevierStyleItalic">Il6</span> mRNA is one of the direct targets of miR-1323 in the PBMCs &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>A&#41;&#46; As shown in <a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>B&#44; an activated inflammation response caused by MPP elevated <span class="elsevierStyleItalic">Il17a</span> and <span class="elsevierStyleItalic">Il6</span> mRNA levels in MPP patients&#46; Pleural effusion is an indicator and clinical manifestation of severe inflammation&#46; Compared with children without pleural effusion&#44; children with MPP and pleural effusion had much higher mRNA levels of Il6 and Il17a in blood samples &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>C&#41;&#46; Through the Pearson Correlation test&#44; the expression level of Il6 was confirmed to have a significant negative correlation with the level of miR-1323 &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>D&#41;&#46;</p><elsevierMultimedia ident="fig0015"></elsevierMultimedia></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">miR-1323 specially regulates Il6 expression in THP-1 cells</span><p id="par0150" class="elsevierStylePara elsevierViewall">Macrophages play a crucial role in the excessive inflammation caused by pneumonia infection&#46; In this study&#44; LPS stimulation in vitro was used to mimic M&#46; pneumoniae infection&#44; as it is well recognized that membrane lipoproteins are immuno-stimulants exerting as lipopolysaccharides &#40;LPS&#41; and play a crucial role in the pathogenesis of inflammatory responses upon M&#46; pneumoniae infection&#46;<a class="elsevierStyleCrossRefs" href="#bib0065"><span class="elsevierStyleSup">13&#44;14</span></a> In THP-1 cells&#44; miR-1323 expression was inhibited by the LPS treatment&#44; with the effect of LPS enhanced by increased time of treatment &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>A&#41;&#46; As shown in <a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>B&#44; the expression of <span class="elsevierStyleItalic">Il6</span>&#44; <span class="elsevierStyleItalic">Tnf</span>&#44; and <span class="elsevierStyleItalic">Il1b</span> were all enhanced by LPS&#44; but only <span class="elsevierStyleItalic">Il6</span> expression was elevated by the inhibition of miR-1323 expression &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>B&#41;&#46; A decreased level of miR-1323 was also shown in <a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>B&#46; Meanwhile&#44; an enhanced expression of miR-1323 declined the mRNA level of <span class="elsevierStyleItalic">Il6</span> after LPS treatment but had no influence on <span class="elsevierStyleItalic">Tnf</span> and <span class="elsevierStyleItalic">Il1b</span> expression &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>C&#41;&#46; An elevated level of miR-1323 was also shown in <a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>C&#46;</p><elsevierMultimedia ident="fig0020"></elsevierMultimedia></span></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Discussion</span><p id="par0155" class="elsevierStylePara elsevierViewall">It is currently believed that MPP is a combination of a direct pathogen invasion and immune injury&#46; Studies demonstrate that the adhesion and proliferation of <span class="elsevierStyleItalic">Mycoplasma pneumoniae</span> to the host respiratory mucosal epithelial cells is the primary prerequisite for clinical symptoms&#46;<a class="elsevierStyleCrossRef" href="#bib0075"><span class="elsevierStyleSup">15</span></a><span class="elsevierStyleItalic">Mycoplasma pneumoniae</span> can firmly adhere and invade the epithelial cells to escape the body&#39;s immune mechanism or drug treatment&#46; It can persist in the respiratory tract for several months&#44; making the patient a chronically infected person or an asymptomatic carrier&#46;<a class="elsevierStyleCrossRef" href="#bib0080"><span class="elsevierStyleSup">16</span></a></p><p id="par0160" class="elsevierStylePara elsevierViewall">MPP has become a common disease in children&#46; Due to the long course of disease and severe symptoms&#44; it can easily cause a variety of extrapulmonary complications&#46;<a class="elsevierStyleCrossRef" href="#bib0085"><span class="elsevierStyleSup">17</span></a> During the pathogenesis of MPP&#44; inflammation mechanisms also play an important role&#46;<a class="elsevierStyleCrossRef" href="#bib0030"><span class="elsevierStyleSup">6</span></a> Immune cells and cytokines dominate in immune injury&#44; and the molecular mechanism that causes pathological changes is not very clear and is the focus of current research&#46;</p><p id="par0165" class="elsevierStylePara elsevierViewall">Recently&#44; studies have shown that the miRNA participates in the occurrence and development of diseases by regulating immune cell development and differentiation&#46; In acute lung injury&#44; the expression of multiple miRNAs in the lungs is dynamically regulated&#44; miR-16 is up-regulated and miR-150 is down-regulated&#46;<a class="elsevierStyleCrossRefs" href="#bib0090"><span class="elsevierStyleSup">18&#44;19</span></a> In mice&#44; overexpression of miR-181a promotes B lymphocyte differentiation and reduces circulating T lymphocytes&#46;<a class="elsevierStyleCrossRef" href="#bib0100"><span class="elsevierStyleSup">20</span></a> The transformation of T cells is promoted by miR-181a&#44; miR-146a and miR-146b&#44; leading to a pro-inflammatory response&#46;<a class="elsevierStyleCrossRef" href="#bib0105"><span class="elsevierStyleSup">21</span></a> miR-155 participates in regulating T helper cell differentiation and mediating T cells to participate in the immune response&#46;<a class="elsevierStyleCrossRef" href="#bib0110"><span class="elsevierStyleSup">22</span></a> In monocytes&#44; miR-155 responds to viruses and bacteria infection and reduces the inflammatory response&#46;<a class="elsevierStyleCrossRef" href="#bib0115"><span class="elsevierStyleSup">23</span></a> The let-7 miRNAs inhibit the expression of IL-13 and regulate IL-13 secretion&#46;<a class="elsevierStyleCrossRef" href="#bib0120"><span class="elsevierStyleSup">24</span></a> In inflammation caused lung damage&#44; the miR-127 expression is down-regulated&#44; and an enhanced miR-127 expression can inhibit the release of cytokines by macrophages&#46;<a class="elsevierStyleCrossRef" href="#bib0125"><span class="elsevierStyleSup">25</span></a></p><p id="par0170" class="elsevierStylePara elsevierViewall">In this study&#44; microarray analysis found that there were differences in the expression of miRNA in the plasma of children with MPP&#44; suggesting that miRNA may participate in the occurrence and development of MPP&#46; There were 23 differentially expressed miRNAs in MPP children&#39;s plasma&#44; 15 miRNAs had enhanced expression and 8 had depressed expression&#46; The most down-regulated miRNAs were miR-1323&#44; miR-98-5p&#44; and miR-152-3p&#46;</p><p id="par0175" class="elsevierStylePara elsevierViewall">It is thought that a strong inflammatory reaction in children with severe MPP can trigger a systemic inflammatory reaction and pleural effusion&#46;<a class="elsevierStyleCrossRef" href="#bib0130"><span class="elsevierStyleSup">26</span></a> According to relevant reports&#44; the infection rate of severe MPP with pleural effusion is as high as 50&#37;&#46;<a class="elsevierStyleCrossRef" href="#bib0135"><span class="elsevierStyleSup">27</span></a> For children with severe MPP and pleural effusion&#44; cephalosporin or penicillin are often used in clinical anti-infective treatment&#46;<a class="elsevierStyleCrossRef" href="#bib0140"><span class="elsevierStyleSup">28</span></a> In this research&#44; among 26 children with MPP&#44; 9 of them had pleural effusion&#46; Levels of mir-1323 and mir-98-5p were significantly lower in MPP patients with pleural effusion than those with no pleural effusion&#46;</p><p id="par0180" class="elsevierStylePara elsevierViewall">Research showed that IL-17&#44; IL-6 and TNF-&#945; are indicators commonly used in clinics to reflect inflammation&#46;<a class="elsevierStyleCrossRef" href="#bib0145"><span class="elsevierStyleSup">29</span></a> It is widely used in infectious diseases&#46; Altered Il17&#44; Il6&#44; and TNF-&#945; expressions are important for the occurrence of <span class="elsevierStyleItalic">Mycoplasma pneumoniae</span> lung infection and MPP pathogenesis&#46;<a class="elsevierStyleCrossRef" href="#bib0045"><span class="elsevierStyleSup">9</span></a> Serum IL-17 is an inflammatory mediator that has a certain effect on the immune response of cells induced by <span class="elsevierStyleItalic">Mycoplasma pneumoniae</span>&#46; IL-17 has played a defensive role in the lung infection of <span class="elsevierStyleItalic">Mycoplasma pneumoniae</span>&#44; which can improve the body&#39;s ability to eliminate pathogens and promote neutrophils to aggregate&#46;<a class="elsevierStyleCrossRef" href="#bib0150"><span class="elsevierStyleSup">30</span></a> Serum IL-6 is a highly active immuno-regulatory factor that participates in pathological processes of lung inflammation&#46; By detecting the expression of Il17 and Il6 levels in a patient&#39;s serum&#44; the patient&#39;s condition can be accurately assessed&#46;</p><p id="par0185" class="elsevierStylePara elsevierViewall">Compared with controls&#44; children with MPP had lower mRNA levels of <span class="elsevierStyleItalic">Il6</span> and <span class="elsevierStyleItalic">Il17a</span>&#46; Compared with children without pleural effusion&#44; children with MPP and pleural effusion had much higher mRNA levels of <span class="elsevierStyleItalic">Il6</span> and <span class="elsevierStyleItalic">Il17a</span>&#46; According to the Target Scan 7&#46;1 database&#44; Il6 is one of the direct targets of miR-1323&#46; The expression level of <span class="elsevierStyleItalic">Il6</span> also showed a significant negative correlation with the level of miR-1323&#46;</p><p id="par0190" class="elsevierStylePara elsevierViewall">After <span class="elsevierStyleItalic">Mycoplasma pneumoniae</span> invades the lower respiratory tract&#44; it stimulates epithelial cells and macrophages to release a variety of cytokines such as IL-1&#946;&#44; IL-4&#44; IL-6&#44; IL-8&#44; IL-18&#44; IFN-&#947;&#44; activates specific and non-specific immune cells&#44; and causes excessive immune inflammation in the pathogenesis of MPP&#46;<a class="elsevierStyleCrossRef" href="#bib0075"><span class="elsevierStyleSup">15</span></a> In severe cases&#44; activated macrophages can cause damage to multiple tissues and organs of the body&#44; causing hemophagocytic syndrome&#46; Kurai et al&#46; found that the levels of IL-17&#44; IL-6&#44; TNF-&#945; and IL-4 in the alveolar lavage fluid of <span class="elsevierStyleItalic">Mycoplasma pneumoniae</span> infected mice increased&#44; aggravating the lung inflammation caused by neutrophils&#46;<a class="elsevierStyleCrossRef" href="#bib0150"><span class="elsevierStyleSup">30</span></a></p><p id="par0195" class="elsevierStylePara elsevierViewall">Based on these results&#44; we used LPS to stimulate THP-1 cells and explored the expression of miR-1323&#44; Il6 and various cytokines in LPS stimulated THP-1 cells&#46; The expression of miR-1323 in THP-1 cells was inhibited by LPS treatment&#46; After the administration of LPS&#44; the expression of <span class="elsevierStyleItalic">Il6</span>&#44; <span class="elsevierStyleItalic">Tnf</span>&#44; and <span class="elsevierStyleItalic">Il1b</span> were all enhanced in THP-1 cells&#46; However&#44; only the expression of Il6 was inhibited by miR-1323 overexpression and promoted through the inhibition of miR-1323 expression&#46;</p><p id="par0200" class="elsevierStylePara elsevierViewall">Cytokines play an important role in the occurrence and development of MPP&#44; and its in-depth study is conducive in exploring the specific pathogenic mechanism of MPP&#46; In recent years&#44; with the increase in the incidence of MPP and with more and more severe and refractory cases&#44; the study of its pathogenesis is conducive to an early clinical identification and effective treatment&#46;</p></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Conclusion</span><p id="par0205" class="elsevierStylePara elsevierViewall">In conclusion&#44; miR-1323 targets the mRNA of <span class="elsevierStyleItalic">Il6</span> and inhibits the expression of <span class="elsevierStyleItalic">Il6</span>&#46; The pathogenesis of MPP inhibits the expression of miR-1323 in macrophages&#44; triggers the overexpression if <span class="elsevierStyleItalic">Il6</span> and enhances inflammation response&#46; It should be noted that blood samples in the current study were not collected at any particular phase or stage of MPP&#44; and it would be important to investigate the temporal expression profile of these miRNAs at different phases of the disease in the future&#46; Also&#44; the sample size is relatively small in this study&#44; and more samples could be analyzed to verify the findings&#46;</p></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Funding</span><p id="par0210" class="elsevierStylePara elsevierViewall">The study was supported by the <span class="elsevierStyleGrantSponsor" id="gs0005">Cangzhou Science and Technology Research and Development Program</span> &#40;<span class="elsevierStyleGrantNumber" refid="gs0005">cz151302039</span>&#41;&#46;</p></span><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Conflict of interest</span><p id="par0215" class="elsevierStylePara elsevierViewall">The authors declare no conflicts of interest&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:10 [
        0 => array:3 [
          "identificador" => "xres1572375"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Objective"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Method"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Conclusion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1416575"
          "titulo" => "Keywords"
        ]
        2 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        3 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Methods"
          "secciones" => array:5 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Patient characteristics"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "THP-1 cell line"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "Microarray analysis of miRNAs in plasma"
            ]
            3 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "qRT-PCR"
            ]
            4 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        4 => array:3 [
          "identificador" => "sec0040"
          "titulo" => "Results"
          "secciones" => array:5 [
            0 => array:2 [
              "identificador" => "sec0045"
              "titulo" => "Participants characteristics"
            ]
            1 => array:2 [
              "identificador" => "sec0050"
              "titulo" => "Altered miRNA profiles in the blood of MPP patients"
            ]
            2 => array:2 [
              "identificador" => "sec0055"
              "titulo" => "miR-1323 expression is significantly depressed in children with MPP"
            ]
            3 => array:2 [
              "identificador" => "sec0060"
              "titulo" => "Il6 is the targeted gene regulated by miRNA-1323"
            ]
            4 => array:2 [
              "identificador" => "sec0065"
              "titulo" => "miR-1323 specially regulates Il6 expression in THP-1 cells"
            ]
          ]
        ]
        5 => array:2 [
          "identificador" => "sec0070"
          "titulo" => "Discussion"
        ]
        6 => array:2 [
          "identificador" => "sec0075"
          "titulo" => "Conclusion"
        ]
        7 => array:2 [
          "identificador" => "sec0080"
          "titulo" => "Funding"
        ]
        8 => array:2 [
          "identificador" => "sec0085"
          "titulo" => "Conflict of interest"
        ]
        9 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2020-08-19"
    "fechaAceptado" => "2020-11-05"
    "PalabrasClave" => array:1 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1416575"
          "palabras" => array:5 [
            0 => "miR-1323"
            1 => "<span class="elsevierStyleItalic">Mycoplasma pneumonia</span>"
            2 => "MPP"
            3 => "<span class="elsevierStyleItalic">Il6</span>"
            4 => "Macrophage"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:1 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Objective</span><p id="spar0065" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">Mycoplasma pneumoniae</span> pneumonia &#40;MPP&#41; is a common respiratory infection in children&#46; Tumor necrosis factor-&#945; &#40;TNF-&#945;&#41;&#44; interleukin-17 &#40;IL-17&#41;&#44; and IL-6 have correlation with <span class="elsevierStyleItalic">Mycoplasma pneumoniae</span> lung infection and MPP pathogenesis&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Method</span><p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">miRNAs participate in the pathogenesis of various diseases by regulating the development and differentiation of the immune cell&#46; Blood was collected and total RNA was isolated&#46; miRNA microarrays were performed to identify differentially expressed miRNAs in MPP patients&#46; The levels of relative miRNAs and mRNAs were evaluated by qRT-PCR&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0075" class="elsevierStyleSimplePara elsevierViewall">There are 23 differentially expressed miRNAs in MPP children&#39;s plasma&#44; 15 miRNAs had enhanced expression and 8 had depressed expression&#46; MPP patients showed lower mir-1323 level in blood samples than healthy controls&#46; MPP patients with pleural effusion had much higher <span class="elsevierStyleItalic">Il6</span> and <span class="elsevierStyleItalic">Il17a</span> mRNA levels than those without pleural effusion&#46; The expression level of Il6 had a negative correlation with miR-1323 level&#46; In the human THP-1 cell line&#44; the level of miR-1323 was significantly reduced through lipopolysaccharides treatment&#46; In THP-1 cells&#44; overexpression or silencing of miR-1323 significantly reduced or promoted <span class="elsevierStyleItalic">Il6</span> expression&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conclusion</span><p id="spar0080" class="elsevierStyleSimplePara elsevierViewall">In conclusion&#44; miR-1323 targets the mRNA of <span class="elsevierStyleItalic">Il6</span> and inhibits the expression of <span class="elsevierStyleItalic">Il6</span>&#46; The pathogenesis of MPP inhibits the expression of miR-1323 in macrophages&#44; triggers the overexpression of <span class="elsevierStyleItalic">Il6</span>&#44; and enhances inflammation response&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Objective"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Method"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Conclusion"
          ]
        ]
      ]
    ]
    "apendice" => array:1 [
      0 => array:1 [
        "seccion" => array:1 [
          0 => array:4 [
            "apendice" => "<p id="par0225" class="elsevierStylePara elsevierViewall">The following is Supplementary data to this article&#58;<elsevierMultimedia ident="upi0005"></elsevierMultimedia></p>"
            "etiqueta" => "Appendix A"
            "titulo" => "Supplementary data"
            "identificador" => "sec0095"
          ]
        ]
      ]
    ]
    "multimedia" => array:5 [
      0 => array:8 [
        "identificador" => "fig0005"
        "etiqueta" => "Figure 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 1233
            "Ancho" => 1508
            "Tamanyo" => 215778
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0005"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Total miRNAs profiling from microarray analysis&#46;</p> <p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">Heat map and cluster analysis of miRNA expression&#46; Individual patient samples are shown in columns and miRNAs&#46; Individual patient samples are shown in columns and miRNAs in rows&#46; Of all differentially expressed miRNAs&#44; 15 miRNAs were up-regulated and 8 miRNAs down-regulated&#46;</p> <p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">MMP&#44; mycoplasma pneumoniae pneumonia&#46;</p>"
        ]
      ]
      1 => array:8 [
        "identificador" => "fig0010"
        "etiqueta" => "Figure 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 2289
            "Ancho" => 2925
            "Tamanyo" => 373044
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0010"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Comparisons of multiple miRNA between MPP cases and healthy controls&#46;</p> <p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">a&#44; Levels of miRNAs in in the PBMCs from the MPP patients and healthy controls&#59; b&#44; Levels of miRNAs in MPP patients with pleura effusion and MPP patients without pleura effusion&#46; Error bars indicate standard error&#46; All qRT-PCR data are presented as the fold induction relative to the <span class="elsevierStyleItalic">Actb</span> mRNA level&#46;</p> <p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">MMP&#44; mycoplasma pneumoniae pneumonia&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "fig0015"
        "etiqueta" => "Figure 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 1254
            "Ancho" => 3008
            "Tamanyo" => 311162
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0015"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleItalic">Il6</span> is the targeted gene regulated by miRNA-1323&#46;</p> <p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">a&#44; The binding site of miR-1323 in the <span class="elsevierStyleItalic">Il6</span> mRNA&#59; b&#44; Expression of Il6 and Il17a in the PBMCs from the children with MPP&#59; c&#44; Expression of <span class="elsevierStyleItalic">Il6</span> and <span class="elsevierStyleItalic">Il17a</span> in MPP cases with and without pleural effusion&#59; d&#44; Correlation between the concentration of Il6 and miR-1323&#46; All qRT-PCR data are presented as the fold induction relative to the <span class="elsevierStyleItalic">Actb</span> mRNA level&#46;</p> <p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">MMP&#44; mycoplasma pneumoniae pneumonia&#46;</p>"
        ]
      ]
      3 => array:8 [
        "identificador" => "fig0020"
        "etiqueta" => "Figure 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 1121
            "Ancho" => 3008
            "Tamanyo" => 166486
          ]
        ]
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at0020"
            "detalle" => "Figure "
            "rol" => "short"
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">miR-1323 specially regulates <span class="elsevierStyleItalic">Il6</span> expression in THP-1 cells&#46;</p> <p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">a&#44; Level of miR-1323 in THP-1 cells treated by LPS&#59; b&#44; THP-1 cells were treated by anti-miR-1323 oligo&#44; mRNA levels of <span class="elsevierStyleItalic">Il6</span>&#44; <span class="elsevierStyleItalic">Tnf</span>&#44; <span class="elsevierStyleItalic">Il1b</span>&#44; and miR-1323 were measure by qRT-PCR&#59; c&#44; miR-1323 was overexpressed in THP-1 cells&#44; mRNA levels of <span class="elsevierStyleItalic">Il6</span>&#44; <span class="elsevierStyleItalic">Tnf</span>&#44; <span class="elsevierStyleItalic">Il1b</span>&#44; and miR-1323 were measured by qRT-PCR&#46; All qRT-PCR data are presented as the fold induction relative to the <span class="elsevierStyleItalic">Actb</span> mRNA level&#46;</p> <p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">MMP&#44; mycoplasma pneumoniae pneumonia&#59; LPS&#44; lipopolysaccharide&#46;</p>"
        ]
      ]
      4 => array:5 [
        "identificador" => "upi0005"
        "tipo" => "MULTIMEDIAECOMPONENTE"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "Ecomponente" => array:2 [
          "fichero" => "mmc1.docx"
          "ficheroTamanyo" => 17012
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0005"
          "bibliografiaReferencia" => array:30 [
            0 => array:3 [
              "identificador" => "bib0005"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "In vitro susceptibilities to and bactericidal activities of garenoxacin &#40;BMS-284756&#41; and other antimicrobial agents against human mycoplasmas and ureaplasmas"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "K&#46;B&#46; Waites"
                            1 => "D&#46;M&#46; Crabb"
                            2 => "X&#46; Bing"
                            3 => "L&#46;B&#46; Duffy"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Antimicrob Agents Chemother&#46;"
                        "fecha" => "2003"
                        "volumen" => "47"
                        "paginaInicial" => "161"
                        "paginaFinal" => "165"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0010"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Difference of clinical features in childhood Mycoplasma pneumoniae pneumonia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46;S&#46; Youn"
                            1 => "K&#46;Y&#46; Lee"
                            2 => "J&#46;Y&#46; Hwang"
                            3 => "J&#46;W&#46; Rhim"
                            4 => "J&#46;H&#46; Kang"
                            5 => "J&#46;S&#46; Lee"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/1471-2431-10-48"
                      "Revista" => array:5 [
                        "tituloSerie" => "BMC Pediatr&#46;"
                        "fecha" => "2010"
                        "volumen" => "10"
                        "paginaInicial" => "48"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20604923"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0015"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The clinical characteristics of corticosteroid-resistant refractory Mycoplasma Pneumoniae pneumonia in children"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "Y&#46; Yan"
                            1 => "Y&#46; Wei"
                            2 => "W&#46; Jiang"
                            3 => "C&#46; Hao"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Sci Rep&#46;"
                        "fecha" => "2016"
                        "volumen" => "6"
                        "paginaInicial" => "39929"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0020"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Clinical features and treatment of macrolide-resistant Mycoplasma pneumoniae pneumonia in children"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Chen"
                            1 => "W&#46;M&#46; Tian"
                            2 => "Q&#46; Chen"
                            3 => "H&#46;Y&#46; Zhao"
                            4 => "P&#46; Huang"
                            5 => "Z&#46;Q&#46; Lin"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Zhongguo Dang Dai Er Ke Za Zhi&#46;"
                        "fecha" => "2018"
                        "volumen" => "20"
                        "paginaInicial" => "629"
                        "paginaFinal" => "634"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30111471"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0025"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Severe acute lung injury caused by Mycoplasma pneumoniae&#58; potential role for steroid pulses in treatment"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "M&#46; Radisic"
                            1 => "A&#46; Torn"
                            2 => "P&#46; Gutierrez"
                            3 => "H&#46;A&#46; Defranchi"
                            4 => "P&#46; Pardo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1086/317498"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Infect Dis&#46;"
                        "fecha" => "2000"
                        "volumen" => "31"
                        "paginaInicial" => "1507"
                        "paginaFinal" => "1511"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11096025"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0030"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Inflammation-inducing Factors of Mycoplasma pneumoniae"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "T&#46; Shimizu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3389/fmicb.2016.00414"
                      "Revista" => array:5 [
                        "tituloSerie" => "Front Microbiol&#46;"
                        "fecha" => "2016"
                        "volumen" => "7"
                        "paginaInicial" => "414"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27065977"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0035"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Pathogenesis of Mycoplasma pneumoniae&#58; an update"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "R&#46; Chaudhry"
                            1 => "A&#46; Ghosh"
                            2 => "A&#46; Chandolia"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.4103/0255-0857.174112"
                      "Revista" => array:6 [
                        "tituloSerie" => "Indian J Med Microbiol&#46;"
                        "fecha" => "2016"
                        "volumen" => "34"
                        "paginaInicial" => "7"
                        "paginaFinal" => "16"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26776112"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0040"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Extra-pulmonary manifestations associated with Mycoplasma pneumoniae pneumonia in adults"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "Y&#46; Kawai"
                            1 => "N&#46; Miyashita"
                            2 => "T&#46; Kato"
                            3 => "N&#46; Okimoto"
                            4 => "M&#46; Narita"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.ejim.2015.11.011"
                      "Revista" => array:7 [
                        "tituloSerie" => "Eur J Intern Med&#46;"
                        "fecha" => "2016"
                        "volumen" => "29"
                        "paginaInicial" => "e9"
                        "paginaFinal" => "e10"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26621759"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0049017218303317"
                          "estado" => "S300"
                          "issn" => "00490172"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0045"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Distribution and expression of IL-17 and related cytokines in children with Mycoplasma pneumoniae Pneumonia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "H&#46; Fan"
                            1 => "B&#46; Lu"
                            2 => "D&#46; Yang"
                            3 => "D&#46; Zhang"
                            4 => "T&#46; Shi"
                            5 => "G&#46; Lu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.7883/yoken.JJID.2019.113"
                      "Revista" => array:6 [
                        "tituloSerie" => "Jpn J Infect Dis&#46;"
                        "fecha" => "2019"
                        "volumen" => "72"
                        "paginaInicial" => "387"
                        "paginaFinal" => "393"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31257245"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0050"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "LncRNA GAS5-mediated miR-1323 promotes tumor progression by targeting TP53INP1 in hepatocellular carcinoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "F&#46; Zhang"
                            1 => "C&#46; Yang"
                            2 => "Z&#46; Xing"
                            3 => "P&#46; Liu"
                            4 => "B&#46; Zhang"
                            5 => "X&#46; Ma"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2147/OTT.S209439"
                      "Revista" => array:6 [
                        "tituloSerie" => "Onco Targets Ther&#46;"
                        "fecha" => "2019"
                        "volumen" => "12"
                        "paginaInicial" => "4013"
                        "paginaFinal" => "4023"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31190897"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0055"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA-1323 downregulation promotes migration and invasion of breast cancer cells by targeting tumour protein D52"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "Y&#46; Xu"
                            1 => "M&#46; Liu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/jb/mvaa035"
                      "Revista" => array:7 [
                        "tituloSerie" => "J Biochem&#46;"
                        "fecha" => "2020"
                        "volumen" => "168"
                        "paginaInicial" => "83"
                        "paginaFinal" => "91"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32211853"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0002870318302928"
                          "estado" => "S300"
                          "issn" => "00028703"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0060"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MicroRNA expression profiling for the prediction of resistance to neoadjuvant radiochemotherapy in squamous cell carcinoma of the esophagus"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46; Slotta-Huspenina"
                            1 => "E&#46; Drecoll"
                            2 => "M&#46; Feith"
                            3 => "D&#46; Habermehl"
                            4 => "S&#46; Combs"
                            5 => "W&#46; Weichert"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s12967-018-1492-9"
                      "Revista" => array:5 [
                        "tituloSerie" => "J Transl Med&#46;"
                        "fecha" => "2018"
                        "volumen" => "16"
                        "paginaInicial" => "109"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29695253"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0065"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Mycoplasma pneumoniae lipids license TLR-4 for activation of NLRP3 inflammasome and autophagy to evoke a proinflammatory response"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H&#46; Luo"
                            1 => "J&#46; He"
                            2 => "L&#46; Qin"
                            3 => "Y&#46; Chen"
                            4 => "L&#46; Chen"
                            5 => "R&#46; Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1111/cei.13510"
                      "Revista" => array:2 [
                        "tituloSerie" => "Clin Exp Immunol&#46;"
                        "fecha" => "2020"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0070"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Mycoplasma pneumoniae-derived lipopeptides induce acute inflammatory responses in the lungs of mice"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "T&#46; Shimizu"
                            1 => "Y&#46; Kida"
                            2 => "K&#46; Kuwano"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1128/IAI.00955-07"
                      "Revista" => array:6 [
                        "tituloSerie" => "Infect Immun&#46;"
                        "fecha" => "2008"
                        "volumen" => "76"
                        "paginaInicial" => "270"
                        "paginaFinal" => "277"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17954722"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0075"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hyperoside inhibits proinflammatory cytokines in human lung epithelial cells infected with Mycoplasma pneumoniae"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "F&#46; Liu"
                            1 => "Y&#46; Zhao"
                            2 => "J&#46; Lu"
                            3 => "S&#46; Chen"
                            4 => "X&#46; Zhang"
                            5 => "W&#46; Mao"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Mol Cell Biochem&#46;"
                        "fecha" => "2019"
                        "volumen" => "453"
                        "paginaInicial" => "179"
                        "paginaFinal" => "186"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0080"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Release of cytokines by human nasal epithelial cells and peripheral blood mononuclear cells infected with Mycoplasma pneumoniae"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46;Y&#46; Kazachkov"
                            1 => "P&#46;C&#46; Hu"
                            2 => "J&#46;L&#46; Carson"
                            3 => "P&#46;C&#46; Murphy"
                            4 => "F&#46;W&#46; Henderson"
                            5 => "T&#46;L&#46; Noah"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1177/153537020222700505"
                      "Revista" => array:6 [
                        "tituloSerie" => "Exp Biol Med &#40;Maywood&#41;&#46;"
                        "fecha" => "2002"
                        "volumen" => "227"
                        "paginaInicial" => "330"
                        "paginaFinal" => "335"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11976403"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0085"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Extra-pulmonary diseases related to Mycoplasma pneumoniae in children&#58; recent insights into the pathogenesis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "D&#46; Poddighe"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1097/BOR.0000000000000494"
                      "Revista" => array:7 [
                        "tituloSerie" => "Curr Opin Rheumatol&#46;"
                        "fecha" => "2018"
                        "volumen" => "30"
                        "paginaInicial" => "380"
                        "paginaFinal" => "387"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/29432224"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0140673604176708"
                          "estado" => "S300"
                          "issn" => "01406736"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0090"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "miR-16 inhibits NLRP3 inflammasome activation by directly targeting TLR4 in acute lung injury"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Yang"
                            1 => "F&#46; Yang"
                            2 => "X&#46; Yu"
                            3 => "B&#46; Wang"
                            4 => "Y&#46; Yang"
                            5 => "X&#46; Zhou"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Biomed Pharmacother&#46;"
                        "fecha" => "2019"
                        "volumen" => "112"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0095"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MiR-150 attenuates LPS-induced acute lung injury via targeting AKT3"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "P&#46; Li"
                            1 => "Y&#46; Yao"
                            2 => "Y&#46; Ma"
                            3 => "Y&#46; Chen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Int Immunopharmacol&#46;"
                        "fecha" => "2019"
                        "volumen" => "75"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0100"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "miR-181a negatively regulates NF-&#954;B signaling and affects activated B-cell-like diffuse large B-cell lymphoma pathogenesis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "G&#46;A&#46; Kozloski"
                            1 => "X&#46; Jiang"
                            2 => "S&#46; Bhatt"
                            3 => "J&#46; Ruiz"
                            4 => "F&#46; Vega"
                            5 => "R&#46; Shaknovich"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Blood&#46;"
                        "fecha" => "2016"
                        "volumen" => "127"
                        "paginaInicial" => "2856"
                        "paginaFinal" => "2866"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0105"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Altered expression of miR-181a and miR-146a does not change the expression of surface NCRs in human NK cells"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46; Rady"
                            1 => "C&#46; Watzl"
                            2 => "M&#46; Claus"
                            3 => "O&#46; Khorshid"
                            4 => "L&#46; Mahran"
                            5 => "K&#46; Abou-Aisha"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Sci Rep&#46;"
                        "fecha" => "2017"
                        "volumen" => "7"
                        "paginaInicial" => "41381"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0110"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Increased Levels of miR-155 are Related to Higher T-Cell Activation in the Peripheral Blood of Patients with Chronic Hepatitis B"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "J&#46; Fang"
                            1 => "L&#46; Zhuge"
                            2 => "H&#46; Rao"
                            3 => "S&#46; Huang"
                            4 => "L&#46; Jin"
                            5 => "J&#46; Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1089/gtmb.2018.0092"
                      "Revista" => array:6 [
                        "tituloSerie" => "Genet Test Mol Biomarkers&#46;"
                        "fecha" => "2019"
                        "volumen" => "23"
                        "paginaInicial" => "118"
                        "paginaFinal" => "123"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30735455"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0115"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MiR-155 enhances phagocytic activity of &#946;-thalassemia&#47;HbE monocytes via targeting of BACH1"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "K&#46; Srinoun"
                            1 => "C&#46; Nopparatana"
                            2 => "M&#46; Wongchanchailert"
                            3 => "S&#46; Fucharoen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s12185-017-2291-4"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Hematol&#46;"
                        "fecha" => "2017"
                        "volumen" => "106"
                        "paginaInicial" => "638"
                        "paginaFinal" => "647"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28685309"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0120"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Let-7 microRNA-mediated regulation of IL-13 and allergic airway inflammation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Kumar"
                            1 => "T&#46; Ahmad"
                            2 => "A&#46; Sharma"
                            3 => "U&#46; Mabalirajan"
                            4 => "A&#46; Kulshreshtha"
                            5 => "A&#46; Agrawal"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jaci.2011.05.025"
                      "Revista" => array:4 [
                        "tituloSerie" => "J Allergy Clin Immunol&#46;"
                        "fecha" => "2011"
                        "volumen" => "128"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21745684"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0125"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MiR-127 modulates macrophage polarization and promotes lung inflammation and injury by activating the JNK pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H&#46; Ying"
                            1 => "Y&#46; Kang"
                            2 => "H&#46; Zhang"
                            3 => "D&#46; Zhao"
                            4 => "J&#46; Xia"
                            5 => "Z&#46; Lu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.4049/jimmunol.1402088"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Immunol&#46;"
                        "fecha" => "2015"
                        "volumen" => "194"
                        "paginaInicial" => "1239"
                        "paginaFinal" => "1251"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25520401"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0130"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Mycoplasma pneumoniae Pneumonia with Worsening Pleural Effusion Despite Treatment with Appropriate Antimicrobials&#58; Case report"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "K&#46;S&#46; Hassan"
                            1 => "G&#46; Al-Khadouri"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.18295/squmj.2018.18.02.022"
                      "Revista" => array:6 [
                        "tituloSerie" => "Sultan Qaboos Univ Med J&#46;"
                        "fecha" => "2018"
                        "volumen" => "18"
                        "paginaInicial" => "e239"
                        "paginaFinal" => "e242"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30210860"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0135"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Clinical relevance and characteristics of pleural effusion in patients with Mycoplasma pneumoniae pneumonia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46;I&#46; Cha"
                            1 => "K&#46;M&#46; Shin"
                            2 => "K&#46;N&#46; Jeon"
                            3 => "S&#46;S&#46; Yoo"
                            4 => "J&#46; Lee"
                            5 => "S&#46;Y&#46; Lee"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Scand J Infect Dis&#46;"
                        "fecha" => "2012"
                        "volumen" => "44"
                        "paginaInicial" => "793"
                        "paginaFinal" => "797"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0140"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Molecular and clinical characteristics of severe Mycoplasma pneumoniae pneumonia in children"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46; Yan"
                            1 => "G&#46; Xue"
                            2 => "H&#46; Zhao"
                            3 => "Y&#46; Feng"
                            4 => "S&#46; Li"
                            5 => "J&#46; Cui"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/ppul.24327"
                      "Revista" => array:7 [
                        "tituloSerie" => "Pediatr Pulmonol&#46;"
                        "fecha" => "2019"
                        "volumen" => "54"
                        "paginaInicial" => "1012"
                        "paginaFinal" => "1021"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/31119869"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0895435618306668"
                          "estado" => "S300"
                          "issn" => "08954356"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0145"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The Physiological functions of IKK-selective substrate identification and their critical roles in diseases"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "J&#46;-S&#46; Yu"
                            1 => "J&#46; Jin"
                            2 => "Y&#46;-y&#46; Li"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "STEMedicine&#46;"
                        "fecha" => "2020"
                        "volumen" => "1"
                        "paginaInicial" => "e49"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0150"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Mycoplasma pneumoniae extract induces an IL-17-associated inflammatory reaction in murine lung&#58; implication for mycoplasmal pneumonia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46; Kurai"
                            1 => "K&#46; Nakagaki"
                            2 => "H&#46; Wada"
                            3 => "T&#46; Saraya"
                            4 => "S&#46; Kamiya"
                            5 => "Y&#46; Fujioka"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s10753-012-9545-3"
                      "Revista" => array:6 [
                        "tituloSerie" => "Inflammation&#46;"
                        "fecha" => "2013"
                        "volumen" => "36"
                        "paginaInicial" => "285"
                        "paginaFinal" => "293"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23001692"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/00217557/0000009700000005/v1_202109160616/S0021755720302515/v1_202109160616/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "10179"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original articles"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/00217557/0000009700000005/v1_202109160616/S0021755720302515/v1_202109160616/en/main.pdf?idApp=UINPBA000049&text.app=https://jped.elsevier.es/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0021755720302515?idApp=UINPBA000049"
]

Article information

ISSN: 00217557
Original language: English

DOI:10.1016/j.jped.2020.11.004

The statistics are updated each day

Year/Month	Html	Pdf	Total

2024 November	4	2	6
2024 October	20	25	45
2024 September	22	29	51
2024 August	38	61	99
2024 July	33	56	89
2024 June	17	39	56
2024 May	20	13	33
2024 April	24	34	58
2024 March	35	16	51
2024 February	21	21	42
2024 January	17	22	39
2023 December	16	27	43
2023 November	23	37	60
2023 October	17	38	55
2023 September	28	42	70
2023 August	16	20	36
2023 July	18	13	31
2023 June	12	15	27
2023 May	29	18	47
2023 April	17	9	26
2023 March	24	20	44
2023 February	23	16	39
2023 January	22	21	43
2022 December	43	27	70
2022 November	32	37	69
2022 October	39	29	68
2022 September	32	42	74
2022 August	32	38	70
2022 July	43	36	79
2022 June	26	27	53
2022 May	20	24	44
2022 April	59	29	88
2022 March	39	32	71
2022 February	20	21	41
2022 January	39	26	65
2021 December	23	27	50
2021 November	22	17	39
2021 October	58	36	94
2021 September	34	17	51
2021 August	4	8	12
2021 July	5	5	10
2021 June	4	8	12
2021 May	3	3	6
2021 April	11	21	32
2021 March	6	6	12
2021 February	4	7	11
2021 January	4	8	12
2020 December	7	9	16

Show all

Indexed in:

Follow us:

Statistics

Indexed in:

Follow us:

Statistics

Subscribe to our newsletter