Original article
IL-17A, MCP-1, CCR-2, and ABCA1 polymorphisms in children with non-alcoholic fatty liver disease
Polimorfismos IL-17A, MCP-1, CCR-2 e ABCA1 em crianças com doença hepática gordurosa não alcoólica
Ulas Emre Akbuluta,
, Hamdi Cihan Emeksizb, Senol Citlic, Alper Han Cebid, Hatice Ayca Ata Korkmaze, Gaye Bakie
Corresponding author
a University of Health Sciences, Antalya Education and Research Hospital, Department of Pediatric Gastroenterology Hepatology and Nutrition, Antalya, Turkey
b Istanbul Medeniyet University, Faculty of Medicine, Department of Pediatric Endocrinology, Istanbul, Turkey
c Gaziosmanpasa University, Faculty of Medicine, Department of Medical Genetics, Tokat, Turkey
d Karadeniz Technical University, Faculty of Medicine, Department of Medical Genetics, Trabzon, Turkey
e University of Health Sciences, Kanuni Training and Research Hospital, Department of Radiology, Trabzon, Turkey
Read
3485
Timeswas read the article
1358
Total PDF
2127
Total HTML
Share statistics
array:25 [ "pii" => "S0021755718300664" "issn" => "00217557" "doi" => "10.1016/j.jped.2018.03.005" "estado" => "S300" "fechaPublicacion" => "2019-05-01" "aid" => "660" "copyright" => "Sociedade Brasileira de Pediatria" "copyrightAnyo" => "2018" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "J Pediatr (Rio J). 2019;95:350-7" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 755 "formatos" => array:3 [ "EPUB" => 82 "HTML" => 477 "PDF" => 196 ] ] "Traduccion" => array:1 [ "pt" => array:20 [ "pii" => "S2255553618300843" "issn" => "22555536" "doi" => "10.1016/j.jpedp.2018.04.009" "estado" => "S300" "fechaPublicacion" => "2019-05-01" "aid" => "660" "copyright" => "Sociedade Brasileira de Pediatria" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "J Pediatr (Rio J). 2019;95:350-7" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 824 "formatos" => array:3 [ "EPUB" => 105 "HTML" => 507 "PDF" => 212 ] ] "pt" => array:12 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Artigo Original</span>" "titulo" => "IL‐17A, MCP‐1, CCR‐2, and ABCA1 polymorphisms in children with non‐alcoholic fatty liver disease" "tienePdf" => "pt" "tieneTextoCompleto" => "pt" "tieneResumen" => array:2 [ 0 => "en" 1 => "pt" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "350" "paginaFinal" => "357" ] ] "titulosAlternativos" => array:1 [ "pt" => array:1 [ "titulo" => "Polimorfismos IL‐17A, MCP‐1, CCR‐2 e ABCA1 em crianças com doença hepática gordurosa não alcoólica" ] ] "contieneResumen" => array:2 [ "en" => true "pt" => true ] "contieneTextoCompleto" => array:1 [ "pt" => true ] "contienePdf" => array:1 [ "pt" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Ulas Emre Akbulut, Hamdi Cihan Emeksiz, Senol Citli, Alper Han Cebi, Hatice Ayca Ata Korkmaz, Gaye Baki" "autores" => array:6 [ 0 => array:2 [ "nombre" => "Ulas Emre" "apellidos" => "Akbulut" ] 1 => array:2 [ "nombre" => "Hamdi Cihan" "apellidos" => "Emeksiz" ] 2 => array:2 [ "nombre" => "Senol" "apellidos" => "Citli" ] 3 => array:2 [ "nombre" => "Alper Han" "apellidos" => "Cebi" ] 4 => array:2 [ "nombre" => "Hatice Ayca Ata" "apellidos" => "Korkmaz" ] 5 => array:2 [ "nombre" => "Gaye" "apellidos" => "Baki" ] ] ] ] ] "idiomaDefecto" => "pt" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S0021755718300664" "doi" => "10.1016/j.jped.2018.03.005" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0021755718300664?idApp=UINPBA000049" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2255553618300843?idApp=UINPBA000049" "url" => "/22555536/0000009500000003/v1_201906040645/S2255553618300843/v1_201906040645/pt/main.assets" ] ] "itemSiguiente" => array:20 [ "pii" => "S0021755717310240" "issn" => "00217557" "doi" => "10.1016/j.jped.2018.04.003" "estado" => "S300" "fechaPublicacion" => "2019-05-01" "aid" => "662" "copyright" => "Sociedade Brasileira de Pediatria" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "J Pediatr (Rio J). 2019;95:358-65" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 843 "formatos" => array:3 [ "EPUB" => 108 "HTML" => 490 "PDF" => 245 ] ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>" "titulo" => "Body mass index and physical fitness in Brazilian adolescents" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "pt" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "358" "paginaFinal" => "365" ] ] "titulosAlternativos" => array:1 [ "pt" => array:1 [ "titulo" => "Índice de massa corporal e aptidão física em adolescentes brasileiros" ] ] "contieneResumen" => array:2 [ "en" => true "pt" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 3995 "Ancho" => 3339 "Tamanyo" => 685702 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Results of the quadratic regressions and the respective equation models by age group for each fitness test for girls and boys.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Vitor P. Lopes, Robert M. Malina, Rossana Gomez-Campos, Marco Cossio-Bolaños, Miguel de Arruda, Edilson Hobold" "autores" => array:6 [ 0 => array:2 [ "nombre" => "Vitor P." "apellidos" => "Lopes" ] 1 => array:2 [ "nombre" => "Robert M." "apellidos" => "Malina" ] 2 => array:2 [ "nombre" => "Rossana" "apellidos" => "Gomez-Campos" ] 3 => array:2 [ "nombre" => "Marco" "apellidos" => "Cossio-Bolaños" ] 4 => array:2 [ "nombre" => "Miguel de" "apellidos" => "Arruda" ] 5 => array:2 [ "nombre" => "Edilson" "apellidos" => "Hobold" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "pt" => array:9 [ "pii" => "S2255553618300867" "doi" => "10.1016/j.jpedp.2018.04.011" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "pt" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2255553618300867?idApp=UINPBA000049" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0021755717310240?idApp=UINPBA000049" "url" => "/00217557/0000009500000003/v1_201905310725/S0021755717310240/v1_201905310725/en/main.assets" ] "itemAnterior" => array:20 [ "pii" => "S0021755717310707" "issn" => "00217557" "doi" => "10.1016/j.jped.2018.03.004" "estado" => "S300" "fechaPublicacion" => "2019-05-01" "aid" => "659" "copyright" => "Sociedade Brasileira de Pediatria" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "J Pediatr (Rio J). 2019;95:342-9" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 836 "formatos" => array:3 [ "EPUB" => 72 "HTML" => 538 "PDF" => 226 ] ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>" "titulo" => "Intra-abdominal fat measurement by ultrasonography: association with anthropometry and metabolic syndrome in adolescents" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "pt" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "342" "paginaFinal" => "349" ] ] "titulosAlternativos" => array:1 [ "pt" => array:1 [ "titulo" => "Gordura intra-abdominal medida por ultrassonografia: relação com antropometria e síndrome metabólica em adolescentes" ] ] "contieneResumen" => array:2 [ "en" => true "pt" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Rommel L.R. Novais, Ana Carolina C. Café, Aisha A. Morais, Wendell C. Bila, Gilson D. da S. Santos, Carlos Alexandre de O. Lopes, Vinícius S. Belo, Márcia Christina C. Romano, Joel A. Lamounier" "autores" => array:9 [ 0 => array:2 [ "nombre" => "Rommel L.R." "apellidos" => "Novais" ] 1 => array:2 [ "nombre" => "Ana Carolina C." "apellidos" => "Café" ] 2 => array:2 [ "nombre" => "Aisha A." "apellidos" => "Morais" ] 3 => array:2 [ "nombre" => "Wendell C." "apellidos" => "Bila" ] 4 => array:2 [ "nombre" => "Gilson D. da S." "apellidos" => "Santos" ] 5 => array:2 [ "nombre" => "Carlos Alexandre de O." "apellidos" => "Lopes" ] 6 => array:2 [ "nombre" => "Vinícius S." "apellidos" => "Belo" ] 7 => array:2 [ "nombre" => "Márcia Christina C." "apellidos" => "Romano" ] 8 => array:2 [ "nombre" => "Joel A." "apellidos" => "Lamounier" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "pt" => array:9 [ "pii" => "S2255553618300879" "doi" => "10.1016/j.jpedp.2018.05.001" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "pt" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2255553618300879?idApp=UINPBA000049" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0021755717310707?idApp=UINPBA000049" "url" => "/00217557/0000009500000003/v1_201905310725/S0021755717310707/v1_201905310725/en/main.assets" ] "en" => array:19 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>" "titulo" => "IL-17A, MCP-1, CCR-2, and ABCA1 polymorphisms in children with non-alcoholic fatty liver disease" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "350" "paginaFinal" => "357" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Ulas Emre Akbulut, Hamdi Cihan Emeksiz, Senol Citli, Alper Han Cebi, Hatice Ayca Ata Korkmaz, Gaye Baki" "autores" => array:6 [ 0 => array:4 [ "nombre" => "Ulas Emre" "apellidos" => "Akbulut" "email" => array:1 [ 0 => "ulasemre@hotmail.com" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "cor0005" ] ] ] 1 => array:3 [ "nombre" => "Hamdi Cihan" "apellidos" => "Emeksiz" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] ] 2 => array:3 [ "nombre" => "Senol" "apellidos" => "Citli" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] ] ] 3 => array:3 [ "nombre" => "Alper Han" "apellidos" => "Cebi" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">d</span>" "identificador" => "aff0025" ] ] ] 4 => array:3 [ "nombre" => "Hatice Ayca Ata" "apellidos" => "Korkmaz" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">e</span>" "identificador" => "aff0020" ] ] ] 5 => array:3 [ "nombre" => "Gaye" "apellidos" => "Baki" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">e</span>" "identificador" => "aff0020" ] ] ] ] "afiliaciones" => array:5 [ 0 => array:3 [ "entidad" => "University of Health Sciences, Antalya Education and Research Hospital, Department of Pediatric Gastroenterology Hepatology and Nutrition, Antalya, Turkey" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Istanbul Medeniyet University, Faculty of Medicine, Department of Pediatric Endocrinology, Istanbul, Turkey" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Gaziosmanpasa University, Faculty of Medicine, Department of Medical Genetics, Tokat, Turkey" "etiqueta" => "c" "identificador" => "aff0015" ] 3 => array:3 [ "entidad" => "Karadeniz Technical University, Faculty of Medicine, Department of Medical Genetics, Trabzon, Turkey" "etiqueta" => "d" "identificador" => "aff0025" ] 4 => array:3 [ "entidad" => "University of Health Sciences, Kanuni Training and Research Hospital, Department of Radiology, Trabzon, Turkey" "etiqueta" => "e" "identificador" => "aff0020" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "pt" => array:1 [ "titulo" => "Polimorfismos IL-17A, MCP-1, CCR-2 e ABCA1 em crianças com doença hepática gordurosa não alcoólica" ] ] "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Non-alcoholic fatty liver disease (NAFLD) is a chronic liver disease caused by excessive fat accumulation in the liver, without a history of chronic alcohol consumption, metabolic liver diseases (Wilson disease), or congenital, viral, or autoimmune liver diseases.<a class="elsevierStyleCrossRef" href="#bib0155"><span class="elsevierStyleSup">1</span></a> NAFLD is included in a broad spectrum of liver damage, ranging from simple steatosis to steatohepatitis, fibrosis, and even cirrhosis.<a class="elsevierStyleCrossRef" href="#bib0155"><span class="elsevierStyleSup">1</span></a> The prevalence of NAFLD has increased significantly due to the worldwide childhood obesity epidemic in the last two decades.<a class="elsevierStyleCrossRef" href="#bib0160"><span class="elsevierStyleSup">2</span></a> NAFLD is closely linked to a sedentary lifestyle, increased body mass index (BMI), and visceral adiposity in children, resulting from excess caloric intake.<a class="elsevierStyleCrossRef" href="#bib0165"><span class="elsevierStyleSup">3</span></a> Several recent studies have reported that, in addition to environmental risk factors, individual genetic variations may also contribute to the development and progression of NAFLD.<a class="elsevierStyleCrossRef" href="#bib0170"><span class="elsevierStyleSup">4</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">Several candidate genes have been implicated in the pathogenesis of NAFLD, including genes involved in hepatic lipid metabolism, insulin sensitivity, and generation of reactive oxidant species or cytokines.<a class="elsevierStyleCrossRef" href="#bib0175"><span class="elsevierStyleSup">5</span></a> Single-nucleotide polymorphisms in genes involved in lipid metabolism (patatin-like phospholipase domain-containing 3 and lipin 1), oxidative stress (superoxide dismutase 2), insulin signalling (insulin receptor substrate-1), and fibrogenesis (Krüppel-like factor 6) have been found to be associated with NAFLD in children.<a class="elsevierStyleCrossRef" href="#bib0160"><span class="elsevierStyleSup">2</span></a> Apart from these well-known polymorphisms, polymorphisms in genes that encode proteins known to be involved in the pathogenesis of NAFLD may also be associated with NAFLD development.</p><p id="par0015" class="elsevierStylePara elsevierViewall">The monocyte chemo-attractant protein-1 (MCP-1), also called chemokine ligand 2 (CCL2), a strong chemotactic factor, plays a role in the activation of monocytes, macrophages, and T-cells in the acute and chronic phases of inflammation.<a class="elsevierStyleCrossRef" href="#bib0180"><span class="elsevierStyleSup">6</span></a> The 2518 A/G polymorphism in the MCP-1 gene affects the level of MCP-1 expression in response to inflammatory stimuli, and is known to be associated with diabetes mellitus and several auto-immune diseases.<a class="elsevierStyleCrossRefs" href="#bib0185"><span class="elsevierStyleSup">7,8</span></a> MCP-1 exerts a chemotactic effect on monocytes and T-cells via the chemokine receptor 2 (CCR2).<a class="elsevierStyleCrossRef" href="#bib0195"><span class="elsevierStyleSup">9</span></a> The 190 G/A polymorphism in the CCR gene has also been reported to be associated with NAFLD development.<a class="elsevierStyleCrossRef" href="#bib0200"><span class="elsevierStyleSup">10</span></a></p><p id="par0020" class="elsevierStylePara elsevierViewall">ATP-binding cassette transporter 1 (ABCA1) is a member of the ATP-binding cassette (ABC) membrane transporter family. ABCA1 expression resulted in increased cholesterol efflux and decreased hepatic lipid contents.<a class="elsevierStyleCrossRef" href="#bib0205"><span class="elsevierStyleSup">11</span></a> Inflammatory stress increases cholesterol accumulation in hepatocytes and inhibits the expression of ABCA1.<a class="elsevierStyleCrossRef" href="#bib0210"><span class="elsevierStyleSup">12</span></a> Furthermore, it has been reported that decreased hepatic ABCA1 expression can cause steatohepatitis in morbidly obese adult patients.<a class="elsevierStyleCrossRef" href="#bib0205"><span class="elsevierStyleSup">11</span></a> Interleukin-17 (IL-17) is a pro-inflammatory molecule produced by T-helper 17 cells (Th17). It mediates the immune response against extra-cellular bacterial and fungal pathogens, and is involved in the development of inflammatory and auto-immune diseases.<a class="elsevierStyleCrossRef" href="#bib0215"><span class="elsevierStyleSup">13</span></a> IL-17 has also been suggested to play a critical role in the development of various liver diseases, such as chronic viral hepatitis, auto-immune diseases, and alcoholic liver diseases.<a class="elsevierStyleCrossRefs" href="#bib0220"><span class="elsevierStyleSup">14–16</span></a> IL-17A (-197 G/A) has been shown to affect the development of ulcerative colitis and rheumatoid arthritis.<a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">17</span></a></p><p id="par0025" class="elsevierStylePara elsevierViewall">The present study aimed to investigate the association between NAFLD and polymorphisms in genes encoding proteins that have been suggested to play a role in NAFLD pathogenesis. To the best of the authors’ knowledge, the relationship between the four single-nucleotide polymorphisms and NAFLD has not been studied previously.</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Methods</span><p id="par0030" class="elsevierStylePara elsevierViewall">The study included obese Turkish patients aged 10–17 years, who presented at the Paediatric Gastroenterology, Hepatology, and Nutrition Clinic and the Paediatric Endocrinology Clinic of the Kanuni Training and Research Hospital between June, 2015 and July, 2016. Patients were considered obese if they had BMI <span class="elsevierStyleItalic">Z</span>-scores ≥2 for age and gender.<a class="elsevierStyleCrossRef" href="#bib0240"><span class="elsevierStyleSup">18</span></a> The 186 patients enrolled in the study were separated into two groups. The NAFLD group (<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>101) comprised patients diagnosed with NAFLD, with alanine aminotransferase (ALT) levels greater than twice the upper limit of the normal level (males<span class="elsevierStyleHsp" style=""></span>><span class="elsevierStyleHsp" style=""></span>50<span class="elsevierStyleHsp" style=""></span>U/L, females<span class="elsevierStyleHsp" style=""></span>><span class="elsevierStyleHsp" style=""></span>44<span class="elsevierStyleHsp" style=""></span>U/L) and fatty liver disease detected by ultrasonography (USG).<a class="elsevierStyleCrossRef" href="#bib0245"><span class="elsevierStyleSup">19</span></a> Patients with other causes of fatty liver disease, such as Wilson disease, α-1 antitrypsin deficiency, auto-immune hepatitis, and viral hepatitis, were excluded. The non-NAFLD group (<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>85) included obese patients without NAFLD (normal ALT levels and USG imaging of liver), having similar anthropometric measurements, insulin resistance, and lipid profile as the NAFLD group. None of the patients in the study underwent liver biopsy. Patients with genetic, endocrine, or metabolic diseases that might cause obesity were not included in the study. In addition, none of the patients had any co-morbid proinflammatory diseases such as inflammatory bowel disease.</p><p id="par0035" class="elsevierStylePara elsevierViewall">The study was performed after receiving approval from the local ethics committee (Registry Url: 2015/27; Identifier: Trabzon Kanuni Training and Research Hospital Clinical Research Ethics Committee) and informed parental consent, in accordance with the Declaration of Helsinki.</p><p id="par0040" class="elsevierStylePara elsevierViewall">All participants were subjected to physical examination. Height was measured to the nearest centimetre using a Harpenden stadiometer (Holtain Limited – Crymych, Dyfed, United Kingdom). Weight was measured unclothed to the nearest 0.1<span class="elsevierStyleHsp" style=""></span>kg using a calibrated balance scale. Body mass index (BMI) was calculated using the formula: weight (kg)/height (m<span class="elsevierStyleSup">2</span>). <span class="elsevierStyleItalic">Z</span>-scores for BMI were calculated using the reference values for Turkish children.<a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">20</span></a> Body fat ratio was calculated with the bioelectrical impedance analysis (BIA) method on a Tanita BC 418 (Tanita Corporation – Tokyo, Japan) device. Waist and hip circumference measurements were obtained using a non-stretch tape measure while the patient stood upright with the feet close together (12–15<span class="elsevierStyleHsp" style=""></span>cm) and arms by the side. The waist-hip ratio was calculated by dividing the waist measurement by the hip measurement.</p><p id="par0045" class="elsevierStylePara elsevierViewall">After a ten-hour fast, peripheral venous blood samples were obtained to determine the levels of insulin (Beckman Coulter DXI 800 – California, United States), high-density lipoprotein (HDL), low-density lipoprotein (LDL), triglycerides, total cholesterol, ALT, aspartate aminotransferase (AST), gamma glutamyltransferase (GGT), and glucose (Beckman Coulter AU5821 – California, United States). The homeostatic model assessment of insulin resistance (HOMA-IR) value was calculated using the formula: glucose<span class="elsevierStyleHsp" style=""></span>×<span class="elsevierStyleHsp" style=""></span>insulin (μU/mL)/405.<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">21</span></a></p><p id="par0050" class="elsevierStylePara elsevierViewall">All examinations were performed by two radiologists with more than ten years of experience in paediatric abdominal imaging and liver steatosis, and the results were determined by consensus. The radiologists were blinded to the clinical findings and laboratory results of the patients. The ultrasound machine used was an Aplio 500 (Toshiba Medical Systems – Otawara, Japan) with linear 4–9<span class="elsevierStyleHsp" style=""></span>MHz transducers. The patients were evaluated in the dorsal decubitus position with the right arm at maximum abduction. The patients were asked to fast for four hours prior to the examination. Longitudinal images of the right liver lobe and the ipsilateral kidney were obtained, including the sagittal hepatic sections. Semi-quantitative grading of fatty changes was performed using the USG findings of fatty liver, vascular blurring, and deep attenuation with liver-kidney contrast.<a class="elsevierStyleCrossRef" href="#bib0260"><span class="elsevierStyleSup">22</span></a></p><p id="par0055" class="elsevierStylePara elsevierViewall">DNA was isolated from the peripheral blood using the automatic QuickGene device. Target areas were amplified using PCR with primary pairs: for MCP1 (2518 A/G) polymorphism, F: 5′ CTTTCCCTTGTGTGTCCCC 3′, R: 5′ TTACTCCTTTTCTCCCCAACC 3′; for CCR-2 rs1799864 polymorphism, F: 5′ ATTTCCCCAGTACATCCACAAC 3′, R: 5′ CCCACAATGGGAGAGTAATAAG 3′; for ABCA1rs4149313 polymorphism, F: 5′ GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 3′, R: 5′ AGAAAGGCAGGAGACAT CGCTT 3′; and for IL-17A rs2275913 polymorphism, F: 5′ AACAAGTAAGAATGAAAAGAGGACATGGT 3′, R: 5′ CCCCCAATGAGGTCATAGAAGAATC 3′.</p><p id="par0060" class="elsevierStylePara elsevierViewall">Sectioning was performed using Pvull (Vivantis) restriction enzymes for MCP1 (-2518 A/G) genotype assignment, FokL (Vivantis) restriction enzymes for CCR-2 rs1799864 genotype assignment, Econl (Vivantis) restriction enzymes for ABCA1 rs4149313 genotype assignment, and BstENI restriction enzymes for IL-17A rs2275913 genotype assignment. After cutting by 2% agarose gel electrophoresis, analysis was performed according to the product size. For control, accuracy was confirmed by 10% random sequence analysis from both groups.</p><p id="par0065" class="elsevierStylePara elsevierViewall">The data were evaluated using SPSS 13.0 (SPSS Inc. – Chicago, IL, United States) statistics software. Descriptive data were presented as mean<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>standard deviation (SD). The analysis of the results was performed using percentage distribution for qualitative data and median interquartile range (IQR) or mean (standard deviation) for quantitative data. For comparison between two groups, Student's <span class="elsevierStyleItalic">t</span>-test for independent paired samples was used for variables showing normal distribution and the Mann–Whitney <span class="elsevierStyleItalic">U</span>-test was used for those not distributed normally. In case of more than two groups, the ANOVA test was used for variables showing normal distribution and the Kruskal–Wallis test was used for those not showing normal distribution. The chi-squared test was used for comparing categorical variables. Genotypic association and the odds ratio (OR) with 95% confidence interval (CI) were estimated by binary logistic regression analysis. In all cases, <span class="elsevierStyleItalic">p</span>-values less than 0.05 were considered statistically significant. Power analysis was performed using normal approximation with the continuity correction method of Open Epi (3.01 version).</p></span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Results</span><p id="par0070" class="elsevierStylePara elsevierViewall">The demographic characteristics, anthropometric measurements, and laboratory data of the patients are shown in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>. No differences were found between the groups in terms of age and gender, BMI, waist/hip ratio, or body fat ratio. In addition to ALT, AST and GGT concentrations were also found to be significantly higher in the NAFLD group than the non-NAFLD group (<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>0.05).</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><p id="par0075" class="elsevierStylePara elsevierViewall">No differences were observed between the groups in terms of genotype and allele frequency for MCP-1 rs1024611, CCR-2 rs1799864, and ABCA1 rs4149313 polymorphisms (<a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>). Among the four variants, only IL-17A rs2275913 was found to be associated with NAFLD. The percentage of IL-17A rs2275913 AA genotypes was significantly higher in the NAFLD group than the non-NAFLD group (<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>0.02, OR: 2.05, 95% CI: 1.12–3.77). The frequency of the A allele of IL-17A rs2275913 was significantly higher in the NAFLD group than the non-NAFLD group (<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>0.01). The power of the study was calculated as 53%. For this power (alpha error: 0.05 and Df: 1), the effect size was calculated as 0.15.</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia><p id="par0080" class="elsevierStylePara elsevierViewall">Univariate logistic regression analysis showed that patients with the IL-17A rs2275913 AA genotype had a 3.00 (95% CI: 1.37–6.58; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>≤<span class="elsevierStyleHsp" style=""></span>0.01) times greater chance of having NAFLD than patients with the GG genotype (<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>).</p><elsevierMultimedia ident="tbl0015"></elsevierMultimedia><p id="par0085" class="elsevierStylePara elsevierViewall">The clinical and biochemical characteristics of the groups, with respect to the IL-17A rs2275913 genotype, are shown in <a class="elsevierStyleCrossRef" href="#tbl0020">Table 4</a>. There were significant differences in AST and ALT concentrations between the three groups (<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>0.04 and <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>0.04, respectively). The serum ALT and AST concentrations were highest in the AA genotype and lowest in the GG genotype.</p><elsevierMultimedia ident="tbl0020"></elsevierMultimedia></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Discussion</span><p id="par0090" class="elsevierStylePara elsevierViewall">This study evaluated the effect of four polymorphisms in the development of NAFLD in obese children. The AA genotype of the IL-17A gene was found more frequently in obese children with NAFLD than in obese children without NAFLD. However, no significant differences were found in MCP-1 rs1024611, CCR-2 rs1799864, and ABCA1 rs4149313 gene polymorphisms between obese Turkish children with and without NAFLD, suggesting that these polymorphisms had no role in the development of NAFLD in obese children.</p><p id="par0095" class="elsevierStylePara elsevierViewall">The balance between pro-inflammatory and anti-inflammatory mechanisms is of critical importance for the development and progression of NAFLD. Stimulation of pro-inflammatory macrophages by pro-inflammatory mediators such as interferon-γ and lipopolysaccharides stimulates the secretion of pro-inflammatory cytokines such as TNFα, IL-6, IL-17, and IL-23, which in turn causes hepatic and metabolic damages.<a class="elsevierStyleCrossRefs" href="#bib0265"><span class="elsevierStyleSup">23,24</span></a> In contrast, regulatory T-cells (Treg) prevent the production of pro-inflammatory cytokines such as IL-17 by expressing anti-inflammatory cytokines such as IL-10, thus controlling inflammation.<a class="elsevierStyleCrossRef" href="#bib0275"><span class="elsevierStyleSup">25</span></a> In experimental studies, the activation of the IL-17 pathway has been shown to play a significant role in the development of NAFLD, progression of steatosis, and formation of fibrosis.<a class="elsevierStyleCrossRef" href="#bib0280"><span class="elsevierStyleSup">26</span></a></p><p id="par0100" class="elsevierStylePara elsevierViewall">The IL-17A rs2275913 polymorphism is known to be strongly associated with IL-17 secretion from T-cells. In an <span class="elsevierStyleItalic">in vitro</span> study by Espinoza et al., a higher level of IL-17 secretion was observed in stimulated T-cells of subjects with the IL-17A rs2275913 AA allele than in subjects without it.<a class="elsevierStyleCrossRef" href="#bib0285"><span class="elsevierStyleSup">27</span></a> Differential binding of the allelic variants of the IL-17A rs2275913 polymorphism to the nuclear factor activated T-cells (NFAT) was proposed to be responsible for the differences in IL-17A secretion.<a class="elsevierStyleCrossRef" href="#bib0285"><span class="elsevierStyleSup">27</span></a> Several inflammatory diseases have been found to be clinically associated with the IL-17A rs2275913 polymorphism. The rs2275913 AA homozygote was found to be associated with increased risk of susceptibility to rheumatoid arthritis in Caucasian populations and ulcerative colitis in Japanese populations.<a class="elsevierStyleCrossRefs" href="#bib0290"><span class="elsevierStyleSup">28,29</span></a></p><p id="par0105" class="elsevierStylePara elsevierViewall">In the present study, it was found that the IL-17A rs2275913 polymorphism was more frequent in obese children with NAFLD than in those without NAFLD. A previous study has also reported an association between IL-17 concentration and ALT concentration in patients with chronic hepatitis B virus infection, reflecting the degree of liver damage.<a class="elsevierStyleCrossRef" href="#bib0300"><span class="elsevierStyleSup">30</span></a> Consistent with these observations, serum ALT as well as serum AST concentrations significantly differed among the IL-17 rs2275913 allele groups (AA, AG, and GG). Serum ALT and AST concentrations were highest in the AA genotype and lowest in the GG genotype. These findings suggested that the AA genotype could be a risk factor for the development of NAFLD in obese patients.</p><p id="par0110" class="elsevierStylePara elsevierViewall">No significant differences were found in MCP-1 rs1024611, CCR-2 rs1799864, and ABCA1 rs4149313 gene polymorphisms between obese children with and without NAFLD, indicating that these polymorphisms did not appear to play a role in the development of NAFLD. However, these polymorphisms may well be related to the development of steatohepatitis in obese children, as it was not possible to assess the degree of hepatic fibrosis and inflammation in these patients.</p><p id="par0115" class="elsevierStylePara elsevierViewall">This study has some limitations. First, the study population was relatively small. The frequency of the studied polymorphisms is known to vary among races. The ethnic structure of the population could affect the prevalence of the polymorphisms. Therefore, these results cannot be generalized to other populations. Second, NAFLD was diagnosed by ultrasonography and by measuring elevated transaminases levels, which are regarded as imperfect tools for detecting steatosis. None of the patients in this study underwent liver biopsy or fibroscan. Therefore, neither fibrosis nor liver inflammation could be assessed in the participants. Consequently, the association between the polymorphisms and the degree of fibrosis and inflammation could not be examined. Third, the effect of the IL-17A rs2275913 polymorphism on gene transcription was not investigated.</p><p id="par0120" class="elsevierStylePara elsevierViewall">In conclusion, the results of this study showed that the AA genotype of the IL-17A gene may be associated with NAFLD development. This polymorphism may serve as a predictor for liver steatosis and provide useful insights for identifying potential therapeutic targets for treating liver diseases in obese patients. Unlike IL-17A (-197 G/A) (rs2275913), no relation was found between the MCP-1 (-2518 A/G) (rs1024611), CCR-2 (190 G/A) (rs1799864), and ABCA1 (883 G/A) (rs4149313) polymorphisms and NAFLD in obese Turkish children. Further large-scale studies on the association between these polymorphisms and NAFLD, as well as fibrosis, need to be performed in different ethnicities in order to confirm these findings.</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Funding</span><p id="par0125" class="elsevierStylePara elsevierViewall">This work was supported by the <span class="elsevierStyleGrantSponsor" id="gs1">Kanuni Training and Research Hospital</span>.</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Conflicts of interest</span><p id="par0130" class="elsevierStylePara elsevierViewall">The authors declare no conflicts of interest.</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Ethics committee approval</span><p id="par0135" class="elsevierStylePara elsevierViewall">Ethics committee approval was received for this study from the ethics committee of Kanuni Training and Research Hospital.</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:12 [ 0 => array:3 [ "identificador" => "xres1197734" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Objective" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusions" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1116451" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres1197733" "titulo" => "Resumo" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Objetivo" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusões" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec1116452" "titulo" => "Palavras-chave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 5 => array:2 [ "identificador" => "sec0010" "titulo" => "Methods" ] 6 => array:2 [ "identificador" => "sec0015" "titulo" => "Results" ] 7 => array:2 [ "identificador" => "sec0020" "titulo" => "Discussion" ] 8 => array:2 [ "identificador" => "sec0025" "titulo" => "Funding" ] 9 => array:2 [ "identificador" => "sec0030" "titulo" => "Conflicts of interest" ] 10 => array:2 [ "identificador" => "sec0035" "titulo" => "Ethics committee approval" ] 11 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2018-01-17" "fechaAceptado" => "2018-03-23" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1116451" "palabras" => array:5 [ 0 => "Liver disease" 1 => "Single-nucleotide polymorphisms" 2 => "Obesity" 3 => "Children" 4 => "Interleukin-17" ] ] ] "pt" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palavras-chave" "identificador" => "xpalclavsec1116452" "palabras" => array:5 [ 0 => "Doença hepática" 1 => "Polimorfismos de nucleotídeo único" 2 => "Obesidade" 3 => "Crianças" 4 => "Interleucina 17" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Objective</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">The prevalence of non-alcoholic fatty liver disease in children has risen significantly, owing to the worldwide childhood obesity epidemic in the last two decades. Non-alcoholic fatty liver disease is closely linked to sedentary lifestyle, increased body mass index, and visceral adiposity. In addition, individual genetic variations also have a role in the development and progression of non-alcoholic fatty liver disease. The aim of this study was to investigate the gene polymorphisms of MCP-1 (-2518 A/G) (rs1024611), CCR-2 (190 G/A) (rs1799864), ABCA1 (883 G/A) (rs4149313), and IL-17A (-197 G/A) (rs2275913) in obese Turkish children with non-alcoholic fatty liver disease.</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Methods</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">The study recruited 186 obese children aged 10–17 years, including 101 children with non-alcoholic fatty liver disease and 85 children without non-alcoholic fatty liver disease. Anthropometric measurements, insulin resistance, a liver panel, a lipid profile, liver ultrasound examination, and genotyping of the four variants were performed.</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">No difference was found between the groups in respect to age and gender, body mass index, waist/hip ratio, or body fat ratio. In addition to the elevated ALT levels, AST and GGT levels were found significantly higher in the non-alcoholic fatty liver disease group compared to the non non-alcoholic fatty liver disease group (<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>0.05). The A-allele of IL-17A (-197 G/A) (rs2275913) was associated with non-alcoholic fatty liver disease (odds ratio [OR] 2.05, 95% confidence interval: 1.12–3.77, <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>0.02).</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conclusions</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">The findings of this study suggest that there may be an association between IL-17A (-197 G/A) (rs2275913) polymorphism and non-alcoholic fatty liver disease development in obese Turkish children.</p></span>" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Objective" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusions" ] ] ] "pt" => array:3 [ "titulo" => "Resumo" "resumen" => "<span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Objetivo</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">A prevalência de doença hepática gordurosa não alcoólica em crianças aumentou significativamente devido à epidemia de obesidade infantil em todo o mundo nas últimas duas décadas. A doença hepática gordurosa não alcoólica está intimamente ligada ao estilo de vida sedentário, ao aumento do índice de massa corporal e à adiposidade visceral. Além disso, variações genéticas individuais também têm um papel no desenvolvimento e na progressão da doença hepática gordurosa não alcoólica. O objetivo deste estudo foi investigar os polimorfismos genéticos MCP-1 (-2518 A/G) (rs1024611), CCR-2 (190 G/A) (rs1799864), ABCA1 (883 G/A) (rs4149313) e IL-17A (-197 G/A) (rs2275913) em crianças turcas obesas com doença hepática gordurosa não alcoólica.</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Métodos</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">O estudo recrutou 186 crianças obesas entre 10 e 17 anos, inclusive 101 crianças com doença hepática gordurosa não alcoólica e 85 crianças sem doença hepática gordurosa não alcoólica. Medidas antropométricas, resistência à insulina, painel hepático, perfil lipídico, exame ultrassonográfico do fígado e genotipagem de quatro variantes foram feitos.</p></span> <span id="abst0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Resultados</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Nenhuma diferença foi encontrada entre os grupos em relação à idade e sexo, índice de massa corporal, relação cintura/quadril ou proporção de gordura corporal. Além dos níveis elevados de ALT, os níveis de AST e GGT foram significativamente maiores no grupo doença hepática gordurosa não alcoólica em comparação com o grupo não doença hepática gordurosa não alcoólica (p<span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>0,05). O alelo A de IL-17A (-197 G/A) (rs2275913) foi associado à doença hepática gordurosa não alcoólica (<span class="elsevierStyleItalic">odds ratio</span> [OR] 2,05, intervalo de confiança de 95%: 1,12-3,77, p<span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>0,02).</p></span> <span id="abst0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Conclusões</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Os achados deste estudo sugerem que pode haver uma associação entre o polimorfismo IL-17A (-197 G/A) (rs2275913) e o desenvolvimento da doença hepática gordurosa não alcoólica em crianças turcas obesas.</p></span>" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Objetivo" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusões" ] ] ] ] "NotaPie" => array:1 [ 0 => array:2 [ "etiqueta" => "☆" "nota" => "<p class="elsevierStyleNotepara" id="npar0030">Please cite this article as: Akbulut UE, Emeksiz HC, Citli S, Cebi AH, Korkmaz HA, Baki G. IL-17A, MCP-1, CCR-2, and ABCA1 polymorphisms in children with non-alcoholic fatty liver disease. J Pediatr (Rio J). 2019;95:350–7.</p>" ] ] "multimedia" => array:4 [ 0 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at1" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "leyenda" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">BMI, body mass index; ALT, alanine aminotransferase; AST, aspartate aminotransferase; GGT, gamma glutamyltransferase; HOMA-IR, homeostesis model assessment-estimated insulin resistance; NAFLD, nonalcoholic fatty liver disease; HDL, high-density lipoprotein; LDL, low-density lipoprotein.</p><p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Values are expressed as median (25th to 75th percentiles) or mean<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>SD, as appropriate.</p><p id="spar0100" class="elsevierStyleSimplePara elsevierViewall">Bold value indicates a <span class="elsevierStyleItalic">p</span>-value less than 0.05.</p>" "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Parameters \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">NAFLD (<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>101) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Non-NAFLD (<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>85) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span>-Value \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">Gender, female, n (%)</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">45 (44.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">36 (42.3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.88 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">Age, years</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">12.98<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>2.26 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">13.31<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>2.52 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.39 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">BMI, kg/m</span><span class="elsevierStyleSup"><span class="elsevierStyleItalic">2</span></span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">30.07<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>4.52 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">29.82<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>4.57 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.94 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Male \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">28.58<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>3.94 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">29.11<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>3.47 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.35 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Female \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">29.04<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>5.84 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">29.76<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>4.94 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.89 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">BMI Z-score</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.38<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>0.35 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.35<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>0.30 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.09 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Male \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.39<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>0.35 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.42<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>0.32 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.24 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Female \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.36<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>0.34 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.32<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>0.29 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.13 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">Waist-hip ratio</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.94<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>0.04 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.92<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.15 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Male \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.95<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>0.04 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.95<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>0.03 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.10 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Female \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.92<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>0.04 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.91<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.09 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">Total body fat, %</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">35.95<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>6.38 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">35.74<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>5.73 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.64 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Male \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">32.57<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>6.34 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">32.51<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>4.91 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.49 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Female \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">39.26<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>5.43 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">36.95<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>5.32 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.73 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">ALT, U/L</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">54.0 (48.5–73.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">19.0 (16.0–26.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><<span class="elsevierStyleBold">0.01</span> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">AST, U/L</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">46.0 (35.0–54.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">21.0 (19.0–26.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><<span class="elsevierStyleBold">0.01</span> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">GGT, U/L</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">28.0 (22.0–37.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">14.0 (12.0–18.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><<span class="elsevierStyleBold">0.01</span> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">Total cholesterol, mg/dL</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">165.0 (141.5–180.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">158.0 (145.7–173.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.52 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">Triglyceride, mg/dL</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">111.0 (82.0–157.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">105.0 (89.0–138.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.80 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">HDL cholesterol, mg/dL</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">42.0 (36.0–52.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">44.0 (38.0–52.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.35 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">LDL cholesterol, mg/dL</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">100.0 (80.7–117.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">91.0 (79.0–106.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.28 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleItalic">HOMA-IR</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4.63<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>1.76 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4.52<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>1.50 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.10 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Male \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4.68<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>1.62 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4.65<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>1.56 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.09 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Female \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4.44<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>1.73 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4.31<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>1.89 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.13 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2045495.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Characteristics of the groups.</p>" ] ] 1 => array:8 [ "identificador" => "tbl0010" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at2" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:3 [ "leyenda" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">NAFLD, nonalcoholic fatty liver disease; OR, odds ratio; CI, confidence interval; Ref, reference.</p><p id="spar0105" class="elsevierStyleSimplePara elsevierViewall">Bold value indicates a <span class="elsevierStyleItalic">p</span>-value less than 0.05.</p>" "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " colspan="3" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Variable</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">NAFLD (<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>101) (%) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Non-NAFLD (<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>85) (%) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span>-Value<a class="elsevierStyleCrossRef" href="#tblfn0005"><span class="elsevierStyleSup">a</span></a> \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR (95% CI) \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">MCP-1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(Yes) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">26 (25.7) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">25 (29.4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.58 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.83 (0.44–1.59) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(No) (Ref) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">75 (74.3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">60 (70.6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(Yes) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">36 (35.6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">32 (37.6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.78 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.91 (0.50–1.67) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(No) (Ref) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">65 (64.4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">53 (62.4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(Yes) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">39 (38.7) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">28 (33.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(No) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">62 (61.3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">57 (77.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">88 (43.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">82 (48.2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.71 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.86 (0.60–1.24) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">G \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(Ref) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">114 (56.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">88 (51.8) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCR-2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(Yes) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">6 (5.9) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5 (5.9) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(No) (Ref) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">95 (94.1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">80 (94.1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(Yes) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">6 (5.9) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">13 (15.3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.06 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.35 (0.13–0.97) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(No) (Ref) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">95 (94.1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">72 (84.7) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(Yes) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">89 (88.2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">67 (78.8) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.08 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.05 (0.91–4.63) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(No) (Ref) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">12 (11.8) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">18 (21.2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(Ref) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">18 (9.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">23 (13.6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">G \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">184 (91.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">147 (86.4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.11 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.51 (0.87–2.64) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ABCA-1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(Yes) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">33 (32.7) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">28 (32.9) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.97 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.83 (0.44–1.59) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(No) (Ref) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">68 (67.3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">57 (67.1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(Yes) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">39 (38.6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">34 (40.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.85 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.91 (0.50–1.67) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(No) (Ref) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">62 (61.4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">51 (60.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(Yes) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">29 (28.7) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">23 (27.1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(No) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">72 (71.3) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">62 (72.9) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">105 (51.9) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">90 (52.9) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.97 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.96 (0.67–1.50) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">G \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(Ref) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">97 (48.1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">80 (47.1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">IL-17A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(Yes) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">48 (47.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">26 (30.6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleBold">0.02</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleBold">2.05 (1.12–3.77)</span> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(No) (Ref) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">53 (52.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">59 (69.4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(Yes) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">37 (36.6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">33 (38.8) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.98 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.38 (0.55–1.88) \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(No) (Ref) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">64 (63.4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">52 (61.2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(Yes) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">16 (15.9) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">26 (30.6) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(No) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">85 (84.1) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">59 (69.4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">A \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">133 (65.8) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">85 (50.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><<span class="elsevierStyleBold">0.01</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleBold">1.78 (1.21–2.65)</span> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">G \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">(Ref) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">69 (33.2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">85 (50.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2045496.png" ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn0005" "etiqueta" => "a" "nota" => "<p class="elsevierStyleNotepara" id="npar0005">As compared with the reference genotype group, the differences in genotype frequencies were analyzed by using the chi-squared test. <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>0.05 was considered to be statistically significant. All four polymorphisms were included in multivariate log regression analysis at the same time.</p> <p class="elsevierStyleNotepara" id="npar0010">Models: MCP-1 AA, AG genotype and A allele; CCR-2AG, GG genotype and G allele; ABCA-1 AA, AG genotype and A allele; IL-17A AA, AG genotype and A allele. Dependent variable: presence of NAFLD.</p>" ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Genotypic and allelic frequency of the MCP-1 rs1024611, CCR-2 rs1799864, ABCA1 rs4149313, and IL-17A rs2275913 polymorphisms in patients, and logistic regression analysis of predictive factors for NAFLD.</p>" ] ] 2 => array:8 [ "identificador" => "tbl0015" "etiqueta" => "Table 3" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at3" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:3 [ "leyenda" => "<p id="spar0080" class="elsevierStyleSimplePara elsevierViewall">NAFLD, nonalcoholic fatty liver disease; OR, odds ratio; CI, confidence interval.</p><p id="spar0110" class="elsevierStyleSimplePara elsevierViewall">Bold value indicates a <span class="elsevierStyleItalic">p</span>-value less than 0.05.</p>" "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Variable \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Coefficient estimate \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">SE \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR (95% CI) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span>-Value \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">IL-17A rs2275913 AA genotype<a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">a</span></a> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.10 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.40 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3.00 (1.37–6.58) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleBold"><0.01</span> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">IL-17A rs2275913 AG genotype \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.60 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.40 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.82 (0.83–3.97) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.13 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2045493.png" ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn0010" "etiqueta" => "a" "nota" => "<p class="elsevierStyleNotepara" id="npar0015">The IL-17A rs2275913 polymorphism has the AA, AG, and GG genotypes, whereas the GG genotype was considered as the reference group.</p>" ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0075" class="elsevierStyleSimplePara elsevierViewall">Univariate logistic regression analysis of predictive factors for NAFLD.</p>" ] ] 3 => array:8 [ "identificador" => "tbl0020" "etiqueta" => "Table 4" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at4" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:3 [ "leyenda" => "<p id="spar0090" class="elsevierStyleSimplePara elsevierViewall">BMI, body mass index; ALT, alanine aminotransferase; AST, aspartate aminotransferase; GGT, gamma glutamyltransferase; HOMA-IR, homeostesis model assessment-estimated insulin resistance; HDL, high-density lipoprotein; LDL, low-density lipoprotein.</p><p id="spar0115" class="elsevierStyleSimplePara elsevierViewall">Bold value indicates a <span class="elsevierStyleItalic">p</span>-value less than 0.05.</p>" "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Variable \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">AA (<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>74) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">AG (<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>70) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">GG (<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>42) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span>-Value<a class="elsevierStyleCrossRef" href="#tblfn0015"><span class="elsevierStyleSup">a</span></a> \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Age, years \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">13.08<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>2.35 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">13.02<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>2.51 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">13.41<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>2.25 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.71 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Gender, female, <span class="elsevierStyleItalic">n</span> (%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">34 (45.9) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">30 (42.8) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">17 (40.4) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.53 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">BMI, kg/m<span class="elsevierStyleSup">2</span> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">29.14<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>4.20 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">29.92<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>4.91 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">31.59<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>4.10 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.32 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">BMI <span class="elsevierStyleItalic">Z</span>-score \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.32<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>0.32 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.36<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>0.33 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.48<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>0.30 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.24 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Waist-hip ratio \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.93<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.93<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>0.04 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.95<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>0.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.12 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Total body fat, % \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">35.95<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>5.54 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">35.73<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>6.62 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">35.91<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>6.48 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.98 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ALT, U/L \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">49.5 (28.0–63.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">41.0 (19.0–54.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">34.0 (20.0–56.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleBold">0.04</span> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AST, U/L \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">34.0 (25.7–51.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">29.0 (21.5–46.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">26.0 (20.0–46.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t"><span class="elsevierStyleBold">0.04</span> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGT, U/L \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">22.0 (15.7–30.2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">18.0 (14.0–29.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">20.0 (14.0–38.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.32 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Total cholesterol, mg/dL \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">162.0 (146.0–181.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">163.0 (150.0–179.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">159.0 (133.0–172.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.06 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Triglycerides, mg/dL \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">112.0 (84.7–165.7) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">110.0 (86.0–142.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">105.0 (87.5–138.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.81 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">HDL cholesterol, mg/dL \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">46.0 (37.0–52.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">44.0 (38.0–52.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">46.0 (36.0–46.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.10 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">LDL cholesterol, mg/dL \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">96.5 (77.5–119.5) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">100.0 (81.0–114.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">91.0 (81.0–111.0) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.10 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">HOMA-IR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4.61<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>1.78 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4.53<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>1.80 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4.65<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>2.17 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.40 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2045494.png" ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn0015" "etiqueta" => "a" "nota" => "<p class="elsevierStyleNotepara" id="npar0020">Calculated for the comparisons between the three genotype groups by using ANOVA for continuous variables and the chi-squared test for categorical variables.</p> <p class="elsevierStyleNotepara" id="npar0025">Values are expressed as median (25th to 75th percentiles) or mean<span class="elsevierStyleHsp" style=""></span>±<span class="elsevierStyleHsp" style=""></span>SD, as appropriate.</p>" ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0085" class="elsevierStyleSimplePara elsevierViewall">Basic characteristics of the subjects across IL-17A rs2275913 genotypes.</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0015" "bibliografiaReferencia" => array:30 [ 0 => array:3 [ "identificador" => "bib0155" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "NASPGHAN clinical practice guideline for the diagnosis and treatment of nonalcoholic fatty liver disease in children: recommendations from the Expert Committee on NAFLD (ECON) and the North American Society of Pediatric Gastroenterology, Hepatology and Nutrition (NASPGHAN)" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M.B. Vos" 1 => "S.H. Abrams" 2 => "S.E. Barlow" 3 => "S. Caprio" 4 => "S.R. Daniels" 5 => "R. Kohli" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1097/MPG.0000000000001482" "Revista" => array:6 [ "tituloSerie" => "J Pediatr Gastroenterol Nutr" "fecha" => "2017" "volumen" => "64" "paginaInicial" => "319" "paginaFinal" => "334" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28107283" "web" => "Medline" ] ] ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0160" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A 4-polymorphism risk score predicts steatohepatitis in children with nonalcoholic fatty liver disease" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "V. Nobili" 1 => "B. Donati" 2 => "N. Panera" 3 => "A. Vongsakulyanon" 4 => "A. Alisi" 5 => "B. Dallapiccola" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1097/MPG.0000000000000279" "Revista" => array:6 [ "tituloSerie" => "J Pediatr Gastroenterol Nutr" "fecha" => "2014" "volumen" => "58" "paginaInicial" => "632" "paginaFinal" => "636" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24345846" "web" => "Medline" ] ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0165" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "A.E. Feldstein" 1 => "P. Charatcharoenwitthaya" 2 => "S. Treeprasertsuk" 3 => "J.T. Benson" 4 => "F.B. Enders" 5 => "P. Angulo" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1136/gut.2008.171280" "Revista" => array:6 [ "tituloSerie" => "Gut" "fecha" => "2009" "volumen" => "58" "paginaInicial" => "1538" "paginaFinal" => "1544" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19625277" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0170" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A common variant in the PNPLA3 gene is a risk factor for non-alcoholic fatty liver disease in obese Taiwanese children" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "Y.C. Lin" 1 => "P.F. Chang" 2 => "F.C. Hu" 3 => "W.S. Yang" 4 => "M.H. Chang" 5 => "Y.H. Ni" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jpeds.2010.11.016" "Revista" => array:6 [ "tituloSerie" => "J Pediatr" "fecha" => "2011" "volumen" => "158" "paginaInicial" => "740" "paginaFinal" => "744" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21168155" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0175" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genetic factors associated with the presence and progression of nonalcoholic fatty liver disease: a narrative review" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "R. Hernaez" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.gastrohep.2011.08.002" "Revista" => array:6 [ "tituloSerie" => "Gastroenterol Hepatol" "fecha" => "2012" "volumen" => "35" "paginaInicial" => "32" "paginaFinal" => "41" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22093607" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0180" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Monocyte chemoattractant protein-1 (MCP-1) in inflammatory joint diseases and its involvement in the cytokine network of rheumatoid synovium" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "M. Harigai" 1 => "M. Hara" 2 => "T. Yoshimura" 3 => "E.J. Leonard" 4 => "K. Inoue" 5 => "S. Kashiwazaki" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Clin Immunol Immunopathol" "fecha" => "1993" "volumen" => "69" "paginaInicial" => "83" "paginaFinal" => "91" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8403545" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0185" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association of polymorphisms in monocyte chemoattractant protein-1 promoter with diabetic kidney failure in Korean patients with type 2 diabetes mellitus" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.Y. Moon" 1 => "L. Jeong" 2 => "S. Lee" 3 => "K. Jeong" 4 => "T. Lee" 5 => "C.G. Ihm" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Korean Med Sci" "fecha" => "2007" "volumen" => "22" "paginaInicial" => "810" "paginaFinal" => "814" ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0190" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Allelic frequency of the MCP-1 promoter -2518 polymorphism in the Korean population and in Korean patients with rheumatoid arthritis, systemic lupus erythematosus and adult onset Still's disease" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S.Y. Hwang" 1 => "M.L. Cho" 2 => "B. Park" 3 => "J.Y. Kim" 4 => "Y.H. Kim" 5 => "D.J. Min" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Eur J Immunogenet" "fecha" => "2002" "volumen" => "29" "paginaInicial" => "413" "paginaFinal" => "416" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12358851" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0302283813007379" "estado" => "S300" "issn" => "03022838" ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0195" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Impact of CCL2 and its receptor CCR2 gene polymorphism in North Indian population: a comparative study in different ethnic groups worldwide" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "V. Singh" 1 => "N. Srivastava" 2 => "P. Srivastava" 3 => "R.D. Mittal" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s12291-012-0265-0" "Revista" => array:6 [ "tituloSerie" => "Indian J Clin Biochem" "fecha" => "2013" "volumen" => "28" "paginaInicial" => "259" "paginaFinal" => "264" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24426221" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0200" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Interaction of polymorphisms of monocyte chemoattractant protein-1 receptor CCR2 gene 190A/G, nicotinamide adenine dinucleotide phosphate oxidase subunit p22phox gene C242T and cigarette smoking increases the risk of nonalcoholic fatty liver disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "C. Zhang" 1 => "L. Guo" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Wei Sheng Yan Jiu" "fecha" => "2015" "volumen" => "44" "paginaInicial" => "730" "paginaFinal" => "737" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26591766" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S147020450770147X" "estado" => "S300" "issn" => "14702045" ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0205" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hepatic miR-33a/miR-144 and their target gene ABCA1 are associated with steatohepatitis in morbidly obese subjects" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J. Vega-Badillo" 1 => "R. Gutiérrez-Vidal" 2 => "H.A. Hernández-Pérez" 3 => "H. Villamil-Ramírez" 4 => "P. León-Mimila" 5 => "F. Sánchez-Muñoz" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/liv.13109" "Revista" => array:6 [ "tituloSerie" => "Liver Int" "fecha" => "2016" "volumen" => "36" "paginaInicial" => "1383" "paginaFinal" => "1391" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26945479" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0210" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Inflammatory stress exacerbates lipid accumulation in hepatic cells and fatty livers of apolipoprotein E knockout mice" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "K.L. Ma" 1 => "X.Z. Ruan" 2 => "S.H. Powis" 3 => "Y. Chen" 4 => "J.F. Moorhead" 5 => "Z. Varghese" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/hep.22423" "Revista" => array:6 [ "tituloSerie" => "Hepatology" "fecha" => "2008" "volumen" => "48" "paginaInicial" => "770" "paginaFinal" => "778" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18752326" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0215" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Autoantibodies against IL-17A, IL-17F, and IL-22 in patients with chronic mucocutaneous candidiasis and autoimmune polyendocrine syndrome type I" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A. Puel" 1 => "R. Doffinger" 2 => "A. Natividad" 3 => "M. Chrabieh" 4 => "G. Barcenas-Morales" 5 => "C. Picard" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1084/jem.20091983" "Revista" => array:6 [ "tituloSerie" => "J Exp Med" "fecha" => "2010" "volumen" => "207" "paginaInicial" => "291" "paginaFinal" => "297" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20123958" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0220" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Th17 cells: the emerging reciprocal partner of regulatory T cells in the liver" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "L. Zhao" 1 => "D. Qiu" 2 => "X. Ma" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1751-2980.2010.00428.x" "Revista" => array:7 [ "tituloSerie" => "J Dig Dis" "fecha" => "2010" "volumen" => "11" "paginaInicial" => "126" "paginaFinal" => "133" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20579216" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S030228381300657X" "estado" => "S300" "issn" => "03022838" ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0225" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "T-helper 17 cell: a distinctive cell in liver diseases" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "C. Ye" 1 => "W.Y. Li" 2 => "M.H. Zheng" 3 => "Y.P. Chen" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1872-034X.2010.00744.x" "Revista" => array:6 [ "tituloSerie" => "Hepatol Res" "fecha" => "2011" "volumen" => "41" "paginaInicial" => "22" "paginaFinal" => "29" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21108703" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0230" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Role of IL-17 and Th17 cells in liver diseases" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "L. Hammerich" 1 => "F. Heymann" 2 => "F. Tacke" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1155/2011/345803" "Revista" => array:5 [ "tituloSerie" => "Clin Dev Immunol" "fecha" => "2011" "volumen" => "2011" "paginaInicial" => "345803" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21197451" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0235" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The influence of polymorphisms of interleukin-17A and interleukin-17F genes on the susceptibility to ulcerative colitis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "T. Arisawa" 1 => "T. Tahara" 2 => "T. Shibata" 3 => "M. Nagasaka" 4 => "M. Nakamura" 5 => "Y. Kamiya" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s10875-007-9125-8" "Revista" => array:6 [ "tituloSerie" => "J Clin Immunol" "fecha" => "2008" "volumen" => "28" "paginaInicial" => "44" "paginaFinal" => "49" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17828618" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0240" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "WHO Child Growth Standards: length/height-for-age, weight-for-age, weight-for-length, weight-for-height and body mass index-for-age: methods and development" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "WHO Multicentre Growth Reference Study Group" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:3 [ "fecha" => "2006" "editorial" => "World Health Organization" "editorialLocalizacion" => "Geneva" ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0245" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Paediatric gastroenterology evaluation of overweight and obese children referred from primary care for suspected non-alcoholic fatty liver disease" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.B. Schwimmer" 1 => "K.P. Newton" 2 => "H.I. Awai" 3 => "L.J. Choi" 4 => "M.A. Garcia" 5 => "L.L. Ellis" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/apt.12518" "Revista" => array:6 [ "tituloSerie" => "Aliment Pharmacol Ther" "fecha" => "2013" "volumen" => "38" "paginaInicial" => "1267" "paginaFinal" => "1277" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24117728" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0250" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Reference values for weight, height, head circumference, and body mass index in Turkish children" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "O. Neyzi" 1 => "R. Bundak" 2 => "G. Gökçay" 3 => "H. Günöz" 4 => "A. Furman" 5 => "F. Darendeliler" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.4274/jcrpe.2183" "Revista" => array:6 [ "tituloSerie" => "J Clin Res Pediatr Endocrinol" "fecha" => "2015" "volumen" => "7" "paginaInicial" => "280" "paginaFinal" => "293" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26777039" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0255" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "D.R. Matthews" 1 => "J.P. Hosker" 2 => "A.S. Rudenski" 3 => "B.A. Naylor" 4 => "D.F. Treacher" 5 => "R.C. Turner" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:7 [ "tituloSerie" => "Diabetologia" "fecha" => "1985" "volumen" => "28" "paginaInicial" => "412" "paginaFinal" => "419" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/3899825" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0959804913007880" "estado" => "S300" "issn" => "09598049" ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0260" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Non-alcoholic fatty liver disease: an early mediator predicting metabolic syndrome in obese children?" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.F. Fu" 1 => "H.B. Shi" 2 => "L.R. Liu" 3 => "P. Jiang" 4 => "L. Liang" 5 => "C.L. Wang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3748/wjg.v17.i6.735" "Revista" => array:6 [ "tituloSerie" => "World J Gastroenterol" "fecha" => "2011" "volumen" => "17" "paginaInicial" => "735" "paginaFinal" => "742" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21390143" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0265" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Regulatory mechanisms for adipose tissue M1 and M2 macrophages in diet-induced obese mice" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S. Fujisaka" 1 => "I. Usui" 2 => "A. Bukhari" 3 => "M. Ikutani" 4 => "T. Oya" 5 => "Y. Kanatani" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2337/db08-1475" "Revista" => array:6 [ "tituloSerie" => "Diabetes" "fecha" => "2009" "volumen" => "58" "paginaInicial" => "2574" "paginaFinal" => "2582" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19690061" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0270" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Peripheral and hepatic vein cytokine levels in correlation with non-alcoholic fatty liver disease (NAFLD)-related metabolic, histological, and haemodynamic features" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "L. Vonghia" 1 => "T. Magrone" 2 => "A. Verrijken" 3 => "P. Michielsen" 4 => "L. Van Gaal" 5 => "E. Jirillo" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1371/journal.pone.0143380" "Revista" => array:5 [ "tituloSerie" => "PLoS ONE" "fecha" => "2015" "volumen" => "10" "paginaInicial" => "e0143380" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26599575" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0275" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Expression of CD4+ forkhead box P3 (FOXP3)+ regulatory T cells in inflammatory bowel disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "Y. Wang" 1 => "X.P. Lıu" 2 => "Z.B. Zhao" 3 => "J.H. Chen" 4 => "C.G. Yu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1751-2980.2011.00505.x" "Revista" => array:6 [ "tituloSerie" => "J Dig Dis" "fecha" => "2011" "volumen" => "12" "paginaInicial" => "286" "paginaFinal" => "294" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21791023" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0280" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Immune imbalances in non-alcoholic fatty liver disease: from general biomarkers and neutrophils to interleukin-17 axis activation and new therapeutic targets" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "F.C. Paquissi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3389/fimmu.2016.00490" "Revista" => array:5 [ "tituloSerie" => "Front Immunol" "fecha" => "2016" "volumen" => "7" "paginaInicial" => "490" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27891128" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0285" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A genetic variant in the IL-17 promoter is functionally associated with acute graft-<span class="elsevierStyleItalic">versus</span>-host disease after unrelated bone marrow transplantation" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.L. Espinoza" 1 => "A. Takami" 2 => "K. Nakata" 3 => "M. Onizuka" 4 => "T. Kawase" 5 => "H. Akiyama" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1371/journal.pone.0026229" "Revista" => array:5 [ "tituloSerie" => "PLoS ONE" "fecha" => "2011" "volumen" => "6" "paginaInicial" => "e26229" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22028838" "web" => "Medline" ] ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0290" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association analysis of the interleukin 17A gene in Caucasian rheumatoid arthritis patients from Norway and New Zealand" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "G.B. Nordang" 1 => "M.K. Viken" 2 => "J.E. Hollis-Moffatt" 3 => "T.R. Merriman" 4 => "Førre ØT" 5 => "K. Helgetveit" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Rheumatology (Oxf)" "fecha" => "2009" "volumen" => "48" "paginaInicial" => "367" "paginaFinal" => "370" ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0295" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Influence of IL17A polymorphisms (rs2275913 and rs3748067) on the susceptibility to ulcerative colitis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "R. Hayashi" 1 => "T. Tahara" 2 => "H. Shiroeda" 3 => "T. Saito" 4 => "M. Nakamura" 5 => "M. Tsutsumi" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s10238-012-0206-5" "Revista" => array:6 [ "tituloSerie" => "Clin Exp Med" "fecha" => "2013" "volumen" => "13" "paginaInicial" => "239" "paginaFinal" => "244" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22955700" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0300" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Interleukin-17-producing CD4(+)T cells increase with severity of liver damage in patients with chronic hepatitis B" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.Y. Zhang" 1 => "Z. Zhang" 2 => "F. Lin" 3 => "Z.S. Zou" 4 => "R.N. Xu" 5 => "L. Jin" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/hep.23273" "Revista" => array:6 [ "tituloSerie" => "Hepatology" "fecha" => "2010" "volumen" => "51" "paginaInicial" => "81" "paginaFinal" => "91" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19842207" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/00217557/0000009500000003/v1_201905310725/S0021755718300664/v1_201905310725/en/main.assets" "Apartado" => array:4 [ "identificador" => "10179" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original articles" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/00217557/0000009500000003/v1_201905310725/S0021755718300664/v1_201905310725/en/main.pdf?idApp=UINPBA000049&text.app=https://jped.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0021755718300664?idApp=UINPBA000049" ]
| Year/Month | Html | Total | |
|---|---|---|---|
| 2024 November | 8 | 4 | 12 |
| 2024 October | 31 | 21 | 52 |
| 2024 September | 27 | 27 | 54 |
| 2024 August | 50 | 31 | 81 |
| 2024 July | 38 | 29 | 67 |
| 2024 June | 37 | 37 | 74 |
| 2024 May | 30 | 14 | 44 |
| 2024 April | 38 | 27 | 65 |
| 2024 March | 34 | 23 | 57 |
| 2024 February | 37 | 24 | 61 |
| 2024 January | 33 | 30 | 63 |
| 2023 December | 40 | 21 | 61 |
| 2023 November | 44 | 28 | 72 |
| 2023 October | 43 | 40 | 83 |
| 2023 September | 34 | 39 | 73 |
| 2023 August | 35 | 17 | 52 |
| 2023 July | 23 | 12 | 35 |
| 2023 June | 23 | 14 | 37 |
| 2023 May | 49 | 19 | 68 |
| 2023 April | 31 | 10 | 41 |
| 2023 March | 63 | 19 | 82 |
| 2023 February | 36 | 28 | 64 |
| 2023 January | 44 | 21 | 65 |
| 2022 December | 83 | 27 | 110 |
| 2022 November | 60 | 26 | 86 |
| 2022 October | 65 | 37 | 102 |
| 2022 September | 41 | 29 | 70 |
| 2022 August | 34 | 36 | 70 |
| 2022 July | 45 | 34 | 79 |
| 2022 June | 34 | 40 | 74 |
| 2022 May | 45 | 41 | 86 |
| 2022 April | 105 | 56 | 161 |
| 2022 March | 62 | 53 | 115 |
| 2022 February | 18 | 17 | 35 |
| 2022 January | 21 | 22 | 43 |
| 2021 December | 22 | 20 | 42 |
| 2021 November | 16 | 16 | 32 |
| 2021 October | 13 | 16 | 29 |
| 2021 September | 9 | 7 | 16 |
| 2021 August | 5 | 6 | 11 |
| 2021 July | 3 | 3 | 6 |
| 2021 June | 6 | 8 | 14 |
| 2021 May | 13 | 14 | 27 |
| 2021 April | 19 | 13 | 32 |
| 2021 March | 12 | 13 | 25 |
| 2021 February | 9 | 1 | 10 |
| 2021 January | 8 | 7 | 15 |
| 2020 December | 9 | 9 | 18 |
| 2020 November | 7 | 12 | 19 |
| 2020 October | 10 | 6 | 16 |
| 2020 September | 13 | 13 | 26 |
| 2020 August | 6 | 1 | 7 |
| 2020 July | 4 | 6 | 10 |
| 2020 June | 4 | 3 | 7 |
| 2020 May | 7 | 5 | 12 |
| 2020 April | 8 | 12 | 20 |
| 2020 March | 3 | 16 | 19 |
| 2020 February | 12 | 11 | 23 |
| 2020 January | 17 | 17 | 34 |
| 2019 December | 11 | 8 | 19 |
| 2019 November | 9 | 4 | 13 |
| 2019 October | 10 | 13 | 23 |
| 2019 September | 14 | 17 | 31 |
| 2019 August | 13 | 11 | 24 |
| 2019 July | 30 | 15 | 45 |
| 2019 June | 29 | 21 | 50 |
| 2019 May | 20 | 13 | 33 |
| 2019 April | 24 | 9 | 33 |
| 2019 March | 13 | 3 | 16 |
| 2019 February | 14 | 8 | 22 |
| 2019 January | 10 | 6 | 16 |
| 2018 December | 19 | 6 | 25 |
| 2018 November | 61 | 0 | 61 |
| 2018 October | 136 | 11 | 147 |
| 2018 September | 18 | 9 | 27 |
| 2018 August | 9 | 9 | 18 |
| 2018 July | 8 | 3 | 11 |
| 2018 June | 3 | 1 | 4 |
| 2018 May | 0 | 3 | 3 |
Show all
