was read the article
array:25 [ "pii" => "S0021755716300973" "issn" => "00217557" "doi" => "10.1016/j.jped.2016.02.014" "estado" => "S300" "fechaPublicacion" => "2016-11-01" "aid" => "423" "copyright" => "Sociedade Brasileira de Pediatria" "copyrightAnyo" => "2016" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "J Pediatr (Rio J). 2016;92:616-23" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 1519 "formatos" => array:3 [ "EPUB" => 99 "HTML" => 994 "PDF" => 426 ] ] "Traduccion" => array:1 [ "pt" => array:19 [ "pii" => "S225555361630101X" "issn" => "22555536" "doi" => "10.1016/j.jpedp.2016.08.005" "estado" => "S300" "fechaPublicacion" => "2016-11-01" "aid" => "423" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "J Pediatr (Rio J). 2016;92:616-23" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 1350 "formatos" => array:3 [ "EPUB" => 90 "HTML" => 889 "PDF" => 371 ] ] "pt" => array:13 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Artigo Original</span>" "titulo" => "Evaluation of the Western blotting method for the diagnosis of congenital toxoplasmosis" "tienePdf" => "pt" "tieneTextoCompleto" => "pt" "tieneResumen" => array:2 [ 0 => "en" 1 => "pt" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "616" "paginaFinal" => "623" ] ] "titulosAlternativos" => array:1 [ "pt" => array:1 [ "titulo" => "Avaliação do método <span class="elsevierStyleItalic">Western Blotting</span> para diagnóstico de toxoplasmose congênita" ] ] "contieneResumen" => array:2 [ "en" => true "pt" => true ] "contieneTextoCompleto" => array:1 [ "pt" => true ] "contienePdf" => array:1 [ "pt" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figura 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1715 "Ancho" => 3121 "Tamanyo" => 371270 ] ] "descripcion" => array:1 [ "pt" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Reconhecimento padrão de proteínas de cepas RH de <span class="elsevierStyleItalic">Toxoplasma gondii</span> por anticorpos IgG com o método <span class="elsevierStyleItalic">Western Blotting</span> (IgG‐WB) em amostras de soro de mães com toxoplasmose adquirida durante a gravidez e seus filhos com suspeita de toxoplasmose congênita. A, IgG‐<span class="elsevierStyleItalic">Western Blotting</span> positivo para toxoplasmose congênita. Bandas iguais reconhecidas por anticorpos IgG com intensidade mais forte na amostra da criança em comparação com a amostra materna. B, IgG‐<span class="elsevierStyleItalic">Western Blotting</span> positivo para toxoplasmose congênita. Bandas diferentes reconhecidas por IgG da amostra da criança em comparação com a amostra materna. C, IgG‐<span class="elsevierStyleItalic">Western Blotting</span> negativo para toxoplasmose congênita. Bandas iguais reconhecidas por anticorpos IgG de amostras da criança e da mãe. M, mãe; C, criança; CP, controle positivo; CN, controle negativo.</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Jaqueline Dario Capobiango, Thaís Cabral Monica, Fernanda Pinto Ferreira, Regina Mitsuka‐Breganó, Italmar Teodorico Navarro, João Luis Garcia, Edna Maria Vissoci Reiche" "autores" => array:7 [ 0 => array:2 [ "nombre" => "Jaqueline Dario" "apellidos" => "Capobiango" ] 1 => array:2 [ "nombre" => "Thaís Cabral" "apellidos" => "Monica" ] 2 => array:2 [ "nombre" => "Fernanda Pinto" "apellidos" => "Ferreira" ] 3 => array:2 [ "nombre" => "Regina" "apellidos" => "Mitsuka‐Breganó" ] 4 => array:2 [ "nombre" => "Italmar Teodorico" "apellidos" => "Navarro" ] 5 => array:2 [ "nombre" => "João Luis" "apellidos" => "Garcia" ] 6 => array:2 [ "nombre" => "Edna Maria Vissoci" "apellidos" => "Reiche" ] ] ] ] ] "idiomaDefecto" => "pt" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S0021755716300973" "doi" => "10.1016/j.jped.2016.02.014" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0021755716300973?idApp=UINPBA000049" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S225555361630101X?idApp=UINPBA000049" "url" => "/22555536/0000009200000006/v1_201611170056/S225555361630101X/v1_201611170056/pt/main.assets" ] ] "itemSiguiente" => array:20 [ "pii" => "S0021755716300997" "issn" => "00217557" "doi" => "10.1016/j.jped.2016.02.015" "estado" => "S300" "fechaPublicacion" => "2016-11-01" "aid" => "424" "copyright" => "Sociedade Brasileira de Pediatria" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "J Pediatr (Rio J). 2016;92:624-30" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 1099 "formatos" => array:3 [ "EPUB" => 102 "HTML" => 637 "PDF" => 360 ] ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>" "titulo" => "Early changes in adipokines from overweight to obesity in children and adolescents" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "pt" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "624" "paginaFinal" => "630" ] ] "titulosAlternativos" => array:1 [ "pt" => array:1 [ "titulo" => "Alterações precoces nos níveis de adipocinas de sobrepeso para obesidade em crianças e adolescentes" ] ] "contieneResumen" => array:2 [ "en" => true "pt" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 756 "Ancho" => 1595 "Tamanyo" => 79182 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Plasma levels of adiponectin, resistin, and leptin (pg/mL) in lean (<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>24), overweight (<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>30), and obese subjects (<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>50). * <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>0.01 (Kruskal–Walis, Dunn's <span class="elsevierStyleItalic">post hoc</span> test). ** <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>0.001 (Kruskal–Walis, Dunn's <span class="elsevierStyleItalic">post hoc</span> test).</p>" ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Rafael Machado Mantovani, Natália Pessoa Rocha, Daniel Massote Magalhães, Izabela Guimarães Barbosa, Antônio Lúcio Teixeira, Ana Cristina Simões e Silva" "autores" => array:6 [ 0 => array:2 [ "nombre" => "Rafael Machado" "apellidos" => "Mantovani" ] 1 => array:2 [ "nombre" => "Natália Pessoa" "apellidos" => "Rocha" ] 2 => array:2 [ "nombre" => "Daniel Massote" "apellidos" => "Magalhães" ] 3 => array:2 [ "nombre" => "Izabela Guimarães" "apellidos" => "Barbosa" ] 4 => array:2 [ "nombre" => "Antônio Lúcio" "apellidos" => "Teixeira" ] 5 => array:2 [ "nombre" => "Ana Cristina" "apellidos" => "Simões e Silva" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "pt" => array:9 [ "pii" => "S2255553616301033" "doi" => "10.1016/j.jpedp.2016.08.007" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "pt" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2255553616301033?idApp=UINPBA000049" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0021755716300997?idApp=UINPBA000049" "url" => "/00217557/0000009200000006/v1_201611170050/S0021755716300997/v1_201611170050/en/main.assets" ] "itemAnterior" => array:20 [ "pii" => "S0021755716300432" "issn" => "00217557" "doi" => "10.1016/j.jped.2016.02.012" "estado" => "S300" "fechaPublicacion" => "2016-11-01" "aid" => "395" "copyright" => "Sociedade Brasileira de Pediatria" "documento" => "article" "crossmark" => 1 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "J Pediatr (Rio J). 2016;92:609-15" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 855 "formatos" => array:3 [ "EPUB" => 73 "HTML" => 508 "PDF" => 274 ] ] "en" => array:12 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>" "titulo" => "Opinions of Brazilian resuscitation instructors regarding resuscitation in the delivery room of extremely preterm newborns" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "pt" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "609" "paginaFinal" => "615" ] ] "titulosAlternativos" => array:1 [ "pt" => array:1 [ "titulo" => "Opiniões dos instrutores de reanimação brasileiros quanto à reanimação em sala de parto de em recém-nascidos pré-termo extremos" ] ] "contieneResumen" => array:2 [ "en" => true "pt" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Cristiane Ribeiro Ambrósio, Maria Fernanda Branco de Almeida, Ruth Guinsburg" "autores" => array:3 [ 0 => array:2 [ "nombre" => "Cristiane Ribeiro" "apellidos" => "Ambrósio" ] 1 => array:2 [ "nombre" => "Maria Fernanda Branco" "apellidos" => "de Almeida" ] 2 => array:2 [ "nombre" => "Ruth" "apellidos" => "Guinsburg" ] ] ] ] ] "idiomaDefecto" => "en" "Traduccion" => array:1 [ "pt" => array:9 [ "pii" => "S2255553616300623" "doi" => "10.1016/j.jpedp.2016.06.001" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "pt" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2255553616300623?idApp=UINPBA000049" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0021755716300432?idApp=UINPBA000049" "url" => "/00217557/0000009200000006/v1_201611170050/S0021755716300432/v1_201611170050/en/main.assets" ] "en" => array:21 [ "idiomaDefecto" => true "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>" "titulo" => "Evaluation of the Western blotting method for the diagnosis of congenital toxoplasmosis" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "616" "paginaFinal" => "623" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Jaqueline Dario Capobiango, Thaís Cabral Monica, Fernanda Pinto Ferreira, Regina Mitsuka-Breganó, Italmar Teodorico Navarro, João Luis Garcia, Edna Maria Vissoci Reiche" "autores" => array:7 [ 0 => array:4 [ "nombre" => "Jaqueline Dario" "apellidos" => "Capobiango" "email" => array:1 [ 0 => "jaquedc@uel.br" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">a</span>" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">*</span>" "identificador" => "cor0005" ] ] ] 1 => array:3 [ "nombre" => "Thaís Cabral" "apellidos" => "Monica" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">b</span>" "identificador" => "aff0010" ] ] ] 2 => array:3 [ "nombre" => "Fernanda Pinto" "apellidos" => "Ferreira" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">c</span>" "identificador" => "aff0015" ] ] ] 3 => array:3 [ "nombre" => "Regina" "apellidos" => "Mitsuka-Breganó" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">d</span>" "identificador" => "aff0020" ] ] ] 4 => array:3 [ "nombre" => "Italmar Teodorico" "apellidos" => "Navarro" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">d</span>" "identificador" => "aff0020" ] ] ] 5 => array:3 [ "nombre" => "João Luis" "apellidos" => "Garcia" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">d</span>" "identificador" => "aff0020" ] ] ] 6 => array:3 [ "nombre" => "Edna Maria Vissoci" "apellidos" => "Reiche" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "<span class="elsevierStyleSup">e</span>" "identificador" => "aff0025" ] ] ] ] "afiliaciones" => array:5 [ 0 => array:3 [ "entidad" => "Universidade Estadual de Londrina (UEL), Centro de Ciências da Saúde, Departamento de Pediatria e Cirurgia Pediátrica, Londrina, PR, Brazil" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Universidade Estadual de Londrina (UEL), Centro de Ciências Agrárias, Programa de Pós-graduação em Ciência Animal, Londrina, PR, Brazil" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Universidade Estadual de Londrina (UEL), Departamento de Medicina Veterinária Preventiva, Laboratório de Zoonoses e Saúde Pública, Londrina, PR, Brazil" "etiqueta" => "c" "identificador" => "aff0015" ] 3 => array:3 [ "entidad" => "Universidade Estadual de Londrina (UEL), Centro de Ciências Agrárias, Departamento de Medicina Veterinária Preventiva, Londrina, PR, Brazil" "etiqueta" => "d" "identificador" => "aff0020" ] 4 => array:3 [ "entidad" => "Universidade Estadual de Londrina (UEL), Departamento de Patologia, Análises Clínicas e Toxicológicas, Londrina, PR, Brazil" "etiqueta" => "e" "identificador" => "aff0025" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "pt" => array:1 [ "titulo" => "Avaliação do método <span class="elsevierStyleItalic">Western Blotting</span> para diagnóstico de toxoplasmose congênita" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1157 "Ancho" => 1527 "Tamanyo" => 82936 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Distribution of the most frequent <span class="elsevierStyleItalic">Toxoplasma gondii</span> proteins recognized by IgG antibodies in the serum of children with congenital toxoplasmosis and children without the disease, according to their molecular weight (kDa) (<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>><span class="elsevierStyleHsp" style=""></span>0.05 for all the recognized proteins).</p>" ] ] ] "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Most children with congenital toxoplasmosis (CT) show no signs or symptoms at birth, yet there is a risk of developing late sequelae, particularly ocular and neurological impairment.<a class="elsevierStyleCrossRef" href="#bib0135"><span class="elsevierStyleSup">1</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">All children are considered suspect whose mothers had acute toxoplasmosis in the course of pregnancy; therefore, these children must be subjected to serological investigation with antibody detection for anti-<span class="elsevierStyleItalic">Toxoplasma gondii</span> (<span class="elsevierStyleItalic">T. gondii</span>).<a class="elsevierStyleCrossRefs" href="#bib0135"><span class="elsevierStyleSup">1,2</span></a></p><p id="par0015" class="elsevierStylePara elsevierViewall">However, a confirmed serological diagnosis of <span class="elsevierStyleItalic">T. gondii</span> infection through the detection of specific IgM and/or IgA antibodies against the parasite does not occur in all newborns.<a class="elsevierStyleCrossRefs" href="#bib0135"><span class="elsevierStyleSup">1,3–5</span></a> Therefore, IgG antibodies against <span class="elsevierStyleItalic">T. gondii</span> in serial serum samples must be analyzed and the child remains under outpatient follow-up, which can take months until the definitive diagnosis.<a class="elsevierStyleCrossRefs" href="#bib0135"><span class="elsevierStyleSup">1,6</span></a></p><p id="par0020" class="elsevierStylePara elsevierViewall">In an infected fetus, IgG and IgM antibodies produced against the antigenic determinants of <span class="elsevierStyleItalic">T. gondii</span> may differ from those anti-<span class="elsevierStyleItalic">T. gondii</span> IgG and IgM antibodies detected in the maternal serum, suggesting a neosynthesis of specific antibodies. Thus, children with CT with non-reactivity in conventional tests for IgM detection have been diagnosed in the first months of life through the Western blot method (WB).<a class="elsevierStyleCrossRefs" href="#bib0165"><span class="elsevierStyleSup">7–9</span></a></p><p id="par0025" class="elsevierStylePara elsevierViewall">There is a need for early and rapid diagnosis using a low complexity method that allows the reference laboratories for toxoplasmosis to differentiate the dubious results obtained using the routine conventional serological methods, such as indirect immunofluorescence (IIF), enzyme-linked immunoassay (ELISA), and immunoassay of microparticles using chemiluminescence (CL). The objective of this study was to evaluate the WB method for the detection of IgG antibodies against <span class="elsevierStyleItalic">T. gondii</span> (IgG-WB) in the serum of the child and his/her mother with acquired toxoplasmosis in pregnancy to assist in the early diagnosis of CT.</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Subjects</span><p id="par0030" class="elsevierStylePara elsevierViewall">The population was comprised of women with suspected acquired toxoplasmosis in pregnancy and their children, assisted at the Pediatric Infectious Disease Outpatient, between June of 2011 and June of 2014. The study included children whose mothers demonstrated reactivity for anti<span class="elsevierStyleItalic">-T. gondii</span> IgM during the pre-natal care. The blood samples of child/mother pairs were collected simultaneously during the first three months of child's life and stored at −20<span class="elsevierStyleHsp" style=""></span>°C for WB. The control group consisted of children whose mothers showed suspected acute toxoplasmosis during pregnancy, but did not meet the criteria for CT.<a class="elsevierStyleCrossRefs" href="#bib0140"><span class="elsevierStyleSup">2,10,11</span></a> In this period, 47 children and their mothers were monitored. Of these, 15 (15.1%) children were diagnosed with CT and in 32 (32.3%), this diagnosis was excluded. Pregnant women received spiramycin or sulfadiazine plus pyrimethamine and folinic acid until childbirth. The suspected infected children received sulfadiazine plus pyrimethamine and folinic acid until the definitive diagnosis.</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Diagnostic criteria in children</span><p id="par0035" class="elsevierStylePara elsevierViewall">CT was considered when the child presented elevation of specific anti-<span class="elsevierStyleItalic">T. gondii</span> IgG titers in sequential samples in the first months of his life and/or the persistence of <span class="elsevierStyleItalic">T. gondii</span> IgG titers after 12 months of life and/or reactivity for anti-<span class="elsevierStyleItalic">T. gondii</span> IgM and/or chorioretinitis and/or lesion of central nervous system (CNS) with reactivity for IgG and/or positivity for the <span class="elsevierStyleItalic">T. gondii</span> DNA using polymerase chain reaction (PCR).<a class="elsevierStyleCrossRefs" href="#bib0140"><span class="elsevierStyleSup">2,10,11</span></a></p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Serological test for the detection of anti-<span class="elsevierStyleItalic">T. gondii</span> IgM and IgG</span><p id="par0040" class="elsevierStylePara elsevierViewall">The serological tests performed during pre-natal care and on samples from children were performed by conventional routine laboratory methods. Anti-<span class="elsevierStyleItalic">T. gondii</span> IgG antibodies were determined by Indirect immunofluorescence (IIF)<a class="elsevierStyleCrossRef" href="#bib0190"><span class="elsevierStyleSup">12</span></a> (Immunoblot, Biolab-Mérieux, Rio de Janeiro, RJ, Brazil), with <span class="elsevierStyleItalic">T. gondii</span> obtained from ascitic fluid of infected mice, and chemiluminescence (CL) (Architect, System Abbott–Wiesbaden, Germany) with p30 (SAG1) and p35 (GRA8) recombinant antigens of <span class="elsevierStyleItalic">T. gondii.</span> Anti-<span class="elsevierStyleItalic">T. gondii</span> IgM antibodies were also detected using CL (Architect, System Abbott–Wiesbaden, Germany) with p30 antigen and total lysate of <span class="elsevierStyleItalic">T. gondii.</span></p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090"><span class="elsevierStyleItalic">T. gondii</span> antigens</span><p id="par0045" class="elsevierStylePara elsevierViewall">Five albino female mice, aged from 45 to 60 days and weighing between 25 and 40<span class="elsevierStyleHsp" style=""></span>g were used for obtaining RH strain tachyzoites of <span class="elsevierStyleItalic">T. gondii</span>. The animals were inoculated by intraperitoneal route with a suspension of live tachyzoites (10<span class="elsevierStyleSup">5</span>/mL) in sterile saline solution. Forty-eight hours after the inoculation, the exudate was obtained by washing the peritoneal cavity with 3.0<span class="elsevierStyleHsp" style=""></span>mL of sterile saline solution. The samples were passed through a 27G needle for rupture of the host cells. Later, they were centrifuged and the sediment was standardized at 10<span class="elsevierStyleSup">9</span><span class="elsevierStyleHsp" style=""></span>tachyzoites/mL by counting in a Neubauer chamber.<a class="elsevierStyleCrossRef" href="#bib0195"><span class="elsevierStyleSup">13</span></a></p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">The IgG-WB Method</span><p id="par0050" class="elsevierStylePara elsevierViewall">The proteins of <span class="elsevierStyleItalic">T. gondii</span> to be used in IgG-WB were quantified using the Lowry et al. method,<a class="elsevierStyleCrossRef" href="#bib0200"><span class="elsevierStyleSup">14</span></a> and polyacrylamide gel 12% was used for electrophoretic separation of proteins with subsequent transfer of the proteins to a nitrocellulose membrane (iBlot<span class="elsevierStyleSup">®</span> Gel Transfer System, California, USA). The nitrocellulose paper was stained with Ponceau and, after washing with distilled water, the nitrocellulose strips were cut and blocked with skim milk 5% plus tris buffered saline (TBS) with Tween<span class="elsevierStyleSup">®</span><span class="elsevierStyleItalic">.</span> Washes were subsequently performed with TBS and skim milk 5% and then, the patient's serum was added diluted in TBS with Tween (Sigma–Aldrich, MO, USA) and skim milk 5%, carried out washes, and added conjugated anti-human IgG (Invitrogen, Life Technologies – CA, USA) diluted in TBS with Tween (Sigma–Aldrich, MO, USA) and skim milk 5%. After further washes the authors added the chromogen substrate diaminobenzidine (DAB) 0.2% (Acrös Organics, Thermo Fisher Scientific – Geel, Belgium) and hydrogen peroxide (100<span class="elsevierStyleHsp" style=""></span>μL). When the bands were visualized, the reaction was stopped with distilled water. Positive and negative control samples for anti-<span class="elsevierStyleItalic">T. gondii</span> were included in each test.</p><p id="par0055" class="elsevierStylePara elsevierViewall">The test was considered positive if the child produced antibodies that recognized at least one band of protein different from the mother or with higher intensity than the corresponding maternal band (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>), characterizing the neosynthesis of anti-<span class="elsevierStyleItalic">T. gondii</span> IgG antibodies.<a class="elsevierStyleCrossRefs" href="#bib0205"><span class="elsevierStyleSup">15–18</span></a> To control the subjectivity of reading, two independent observers read the IgG-WB patterns blindly and without knowledge of the previous serological results of the conventional tests; there was concordance in 100.0% of the results.</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><p id="par0060" class="elsevierStylePara elsevierViewall">The specificity of the IgG-WB method was determined with 26 serum samples obtained from individuals seronegative for toxoplasmosis (anti-<span class="elsevierStyleItalic">T. gondii</span> IgG and IgM non-reactive by CL) and with seroreactivity to antibodies against other pathogens, such as <span class="elsevierStyleItalic">Treponema pallidum</span> (<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>5), <span class="elsevierStyleItalic">Trypanosoma cruzi</span> (<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>5), <span class="elsevierStyleItalic">Leishmania spp.</span> (<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>2), <span class="elsevierStyleItalic">Paracoccidioides brasilienses</span> (<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>5), or seroreactivity to serological markers of autoimmunity disorders, such as antinuclear antibodies (<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>5) and anti-DNA double strand antibodies (<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>4).</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">PCR for detection of T. gondii DNA</span><p id="par0065" class="elsevierStylePara elsevierViewall">The DNA was extracted from peripheral blood cells of children, collected with EDTA as the anticoagulant up to three months after birth, using the kit EasyPrep DNA Mini I (EasyGen, Favorgen Biotech – Austria). The DNA amplification of <span class="elsevierStyleItalic">T. gondii</span> was performed using the method described by Homan et al.<a class="elsevierStyleCrossRef" href="#bib0225"><span class="elsevierStyleSup">19</span></a> Primers Tox4 (CGCTGCAGGGAGGAAGACGAAAGTTG) and Tox5 (CGCTGCAGACACAGTGCATCTGGATT) were used for the amplification of a fragment of 529 base pairs (bp; GenBank No. AFI46527) of <span class="elsevierStyleItalic">T. gondii</span> DNA. PCR was performed in a final volume of 22.5<span class="elsevierStyleHsp" style=""></span>μL, containing 2.5<span class="elsevierStyleHsp" style=""></span>μL of DNA extracted from the sample; 1.0<span class="elsevierStyleHsp" style=""></span>μL of 1.0<span class="elsevierStyleHsp" style=""></span>mM for each primer, 100<span class="elsevierStyleHsp" style=""></span>mM of dNTP (Invitrogen, Life Technologies – CA, United States), 60<span class="elsevierStyleHsp" style=""></span>mM Tris–HCl (pH 9.0), 15<span class="elsevierStyleHsp" style=""></span>mM (NH4)<span class="elsevierStyleInf">2</span>SO<span class="elsevierStyleInf">4</span>, 2<span class="elsevierStyleHsp" style=""></span>mM MgCl<span class="elsevierStyleInf">2</span>, and 0.25<span class="elsevierStyleHsp" style=""></span>μL Taq DNA polymerase (Invitrogen, Life Technologies – CA, United States), also completed with 7.75<span class="elsevierStyleHsp" style=""></span>μL of Milli Q water. The amplification was performed with 35 cycles in a thermal cycler (PTC-100, MJ Research – CA, United States), using the following cycling condition: 7<span class="elsevierStyleHsp" style=""></span>min at 94<span class="elsevierStyleHsp" style=""></span>°C for denaturation in the 1st cycle, followed by 33 cycles of 1<span class="elsevierStyleHsp" style=""></span>min at 94<span class="elsevierStyleHsp" style=""></span>C for denaturation, 1<span class="elsevierStyleHsp" style=""></span>min at 55<span class="elsevierStyleHsp" style=""></span>°C for annealing, and 1<span class="elsevierStyleHsp" style=""></span>min at 72<span class="elsevierStyleHsp" style=""></span>°C for extension; cycle 35 was followed by a final extension of 10<span class="elsevierStyleHsp" style=""></span>min at 72<span class="elsevierStyleHsp" style=""></span>°C. Aliquots of each PCR product were subjected to electrophoresis in 2% agarose gel. RH strain Tachyzoites (10<span class="elsevierStyleSup">7</span>/mL) had their DNA extracted to be used as positive control. The water was regarded as the negative control. Positive and negative control samples for <span class="elsevierStyleItalic">T. gondii</span> were included in each test.</p></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Statistical analysis</span><p id="par0070" class="elsevierStylePara elsevierViewall">The statistical analysis was done on GraphPad Prism 5 (GraphPad Software, Inc. – San Diego, United States). Categorical variables were expressed as absolute number (<span class="elsevierStyleItalic">n</span>) and percentage (%) and analyzed by the chi-squared test or Fisher's exact test. Parameters of sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) were calculated, with a confidence interval (CI) of 95.0%. Values of <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>0.05 were considered statistically significant.</p><p id="par0075" class="elsevierStylePara elsevierViewall">The study was approved by the Ethics Committee for Research Involving Human Beings. All mothers participated voluntarily and signed the informed consent.</p></span></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Results</span><p id="par0080" class="elsevierStylePara elsevierViewall">Of the 15 children with CT, 12 (80.0%) were symptomatic and met the clinical criteria for the definition of the disease (nine with cerebral calcification, eight with chorioretinitis, and four with hydrocephalus), six (40.0%) presented reactivity for anti-<span class="elsevierStyleItalic">T. gondii</span> IgM, five (33.3%) showed elevation of anti-<span class="elsevierStyleItalic">T. gondii</span> IgG in the first months of life, and one (6.7%) showed persistence of anti-<span class="elsevierStyleItalic">T. gondii</span> IgG titers in sequential samples. Five of the seven children (71.4%) who underwent PCR to detect <span class="elsevierStyleItalic">T. gondii</span> DNA showed positive results (<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>).</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><p id="par0085" class="elsevierStylePara elsevierViewall">Among the 15 children with CT, the IgG-WB test was positive in nine (60.0%), and among the 32 children without CT, the test was positive in 18 (56.3%), which resulted in a sensitivity of 60.0% (95% CI: 32.3–83.7%), specificity of 43.7% (95% CI: 26.4–62.3%), PPV of 33.3% (95% CI: 16.5–54.0%), and NPV of 70.0% (95% CI: 45.7–88.1%) (<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>0.05875). Among the children with CT, two presented negative IgG-WB and were positive for anti-<span class="elsevierStyleItalic">T. gondii</span> IgM; five children presented positive IgG-WB and were negative for anti-<span class="elsevierStyleItalic">T. gondii</span> IgM, four presented both tests as positive, and four presented both tests as negative.</p><p id="par0090" class="elsevierStylePara elsevierViewall">The molecular weight (MW) of the protein recognized by anti-<span class="elsevierStyleItalic">T. gondii</span> IgG in the serum of children with CT ranged from 2 to 94<span class="elsevierStyleHsp" style=""></span>kDa, and regarding the proteins recognized by IgG antibodies in the serum of the non-infected, the MW ranged from 1 to 160<span class="elsevierStyleHsp" style=""></span>kDa. Among the nine children diagnosed through IgG-WB, seven presented different bands from those observed in the maternal serum and two presented bands of greater intensity than those presented by their mother's sample. The dominant bands that were recognized by IgG antibodies from samples of children with CT and the non-infected are demonstrated in <a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>.</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia><p id="par0095" class="elsevierStylePara elsevierViewall">As for the 26 samples from patients with other diseases, two showed no reactivity and 24 showed reactivity for IgG antibodies that recognized proteins with MW ranging from 17 to 118<span class="elsevierStyleHsp" style=""></span>kDa. Those most frequently recognized were p22 (11/40.7%), p34 (9/33.3%), p38 (8/29.6%), p94 (6/22.2%), p56 (5/18.5%), and p30 (5/18.5%).</p><p id="par0100" class="elsevierStylePara elsevierViewall">The analysis of the results of anti-<span class="elsevierStyleItalic">T. gondii</span> IgM using CL showed sensitivity of 40.0% (95% CI: 16.3–67.6%), specificity of 100.0% (95% CI: 89.1–100.0%), PPV of 100.0% (95% CI: 54.1–100.0%), and NPV of 78.1% (95% CI: 62.4–89.4%; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>0.0005). For the detection of the parasite's DNA using PCR, the sensitivity was 71.4% (95% CI: 29.0–96.3%), specificity of 100.0% (95% CI: 69.2–100.0%), PPV of 100.0% (95% CI: 47.8–100.0%), and NPV of 83.3% (95% CI: 51.6–98.0%; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>0.0034).</p><p id="par0105" class="elsevierStylePara elsevierViewall">The sensitivity and specificity of IgG-WB when associated with other markers of CT – such as the presence of anti-<span class="elsevierStyleItalic">T. gondii</span> IgM, positive PCR, and the clinical symptoms – are shown in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>.</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia><p id="par0110" class="elsevierStylePara elsevierViewall">IgG-WB was positive in six of nine patients (66.7%) with eye injuries and in three of six patients (50.0%) with CT without eye injuries (<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>=<span class="elsevierStyleHsp" style=""></span>0.6224), with sensitivity of 66.7% (95% CI: 29.9–92.5%), specificity of 50.0% (95% CI: 11.8–88.2%), PPV of 66.7% (95% CI: 29.9–92.5%), and NPV of 50% (95% CI: 11.8–88.2%).</p></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Discussion</span><p id="par0115" class="elsevierStylePara elsevierViewall">The diagnosis of CT is a challenge in clinical practice, because the sensitivity of anti-<span class="elsevierStyleItalic">T. gondii</span> IgM using conventional serological methods varies widely, from 48.3% to 75.0%.<a class="elsevierStyleCrossRefs" href="#bib0145"><span class="elsevierStyleSup">3–5</span></a> The absence of anti-<span class="elsevierStyleItalic">T. gondii</span> IgM can be justified by the fact that fetal infection occurred at the beginning of pregnancy or as a result of maternal treatment for toxoplasmosis carried out during the first two trimesters of pregnancy, which would cause blockage or delay of the immune response.<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">20</span></a> Moreover, the delay or the absence of detectable immune response by standard methods (IgG and IgM dosage or WB) could be related to differences in the individual immune response. Another disadvantage of this marker is the delay in the sample collection, with decreased positivity of IgM after the first 30 days of life.<a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">21</span></a> Therefore, it is often necessary to monitor the serological results with the identification of stable or increasing titers of anti-<span class="elsevierStyleItalic">T. gondii</span> IgG, which delays the diagnosis and causes uncertainty to the family.<a class="elsevierStyleCrossRef" href="#bib0210"><span class="elsevierStyleSup">16</span></a> In this context, the IgG-WB can be used to compare the patterns of antibodies against <span class="elsevierStyleItalic">T. gondii</span> in serum samples from the mothers and their children, and determine if the antibodies are transmitted passively or synthesized by the fetus or infant in cases of CT.<a class="elsevierStyleCrossRef" href="#bib0205"><span class="elsevierStyleSup">15</span></a></p><p id="par0120" class="elsevierStylePara elsevierViewall">Other authors have observed a higher contribution of IgG-WB to the diagnosis of CT in the first months of life.<a class="elsevierStyleCrossRefs" href="#bib0240"><span class="elsevierStyleSup">22,23</span></a> In addition, the association of IgG-WB with other serological methods can increase the probability of diagnosis. In a cohort of children, the sensitivity of IgG-WB was 82.4% and increased to 85.7% when IgG-WB was associated with the presence of IgM and/or IgA anti-<span class="elsevierStyleItalic">T. gondii</span> using ELISA.<a class="elsevierStyleCrossRef" href="#bib0210"><span class="elsevierStyleSup">16</span></a> Another study showed that the combination of IgA and IgM immunocapture tests, the analysis of IgG an IgM WB patterns, and the combination of both techniques allowed the detection of 94.0%, 94.0%, and 100.0% of cases, respectively.<a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">24</span></a></p><p id="par0125" class="elsevierStylePara elsevierViewall">The IgG-WB results obtained in the present study are close to those found by other authors, who reported sensitivity of 73.5%.<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">18</span></a> These same authors reported that the combination of IgG-WB and IgM-WB increased the sensitivity to 86.5%.<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">18</span></a></p><p id="par0130" class="elsevierStylePara elsevierViewall">The lower sensitivity obtained in this study can be explained, in part, because all the patients with suspected CT were treated with sulfadiazine, pyrimethamine, and folinic acid during the investigation, which could inhibit the neosynthesis of antibodies.<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">20</span></a></p><p id="par0135" class="elsevierStylePara elsevierViewall">Another strategy to improve the sensitivity of this proposed method is the repetition of IgG-WB throughout the first three months of life.<a class="elsevierStyleCrossRef" href="#bib0170"><span class="elsevierStyleSup">8</span></a> In a study with samples collected at birth, the sensitivity of anti-<span class="elsevierStyleItalic">T. gondii</span> IgM by conventional methods (ISAGA and ELISA) was 52.0% and for WB (with IgG and IgM) was 67.0%. By combining the two methods, the sensitivity increased to 78.0% at birth and to 85.0% at three months of life, with the detection of 94.0% of the cases of CT.<a class="elsevierStyleCrossRef" href="#bib0215"><span class="elsevierStyleSup">17</span></a></p><p id="par0140" class="elsevierStylePara elsevierViewall">The present study analyzed some sequential samples of IgG-WB. Among infected children, with false-negative result in the first sample by IgG-WB, two of six (33.3%) children have different recognized proteins in relation to the maternal sample in the second collection, characterizing neosynthesis of anti-<span class="elsevierStyleItalic">T. gondii</span> IgG, which justifies the need for repetition of IgG-WB in serial samples.</p><p id="par0145" class="elsevierStylePara elsevierViewall">In a previous analysis, the time of maternal sample collection influenced the outcome of the IgG-WB test, because mothers who received treatment for toxoplasmosis during pregnancy may no longer react to the antigens of <span class="elsevierStyleItalic">T. gondii</span> in the late after birth period, with false-negative result.<a class="elsevierStyleCrossRef" href="#bib0210"><span class="elsevierStyleSup">16</span></a> In the present study, this phenomenon was observed in one mother of an infected child. However, the majority of mothers showed an increase in the number of bands recognized in the samples collected immediately after the interruption of treatment at delivery.</p><p id="par0150" class="elsevierStylePara elsevierViewall">In a previous study, the MW of antigenic bands that were recognized by IgG of neonates with CT varied from 21 to 116<span class="elsevierStyleHsp" style=""></span>kDa.<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">18</span></a> In the present study, similar to that found by other authors,<a class="elsevierStyleCrossRefs" href="#bib0205"><span class="elsevierStyleSup">15,16</span></a> the antibodies found with high frequency in infected children were those against the proteins with MW higher than 30<span class="elsevierStyleHsp" style=""></span>kDa. The differences in the MW of recognized proteins reported by previous studies can be explained by different methodological requirements, such as the preparation of the <span class="elsevierStyleItalic">T. gondii</span> antigen, conditions of electrophoresis on acrylamide gel, and the serum dilutions.<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">20</span></a> Another explanation is the genetic diversity among strains of <span class="elsevierStyleItalic">T. gondii</span>, which can lead to the recognition of different proteins, besides the fact that some individuals present IgG that recognizes multiple proteins, while others, a single protein.<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">25</span></a></p><p id="par0155" class="elsevierStylePara elsevierViewall">In the present study, IgG-WB was also useful in demonstrating the active synthesis of anti-<span class="elsevierStyleItalic">T. gondii</span> IgG in patients with IgG non-reactive by conventional methods. In Patient 4, with anti-<span class="elsevierStyleItalic">T. gondii</span> IgG titer<span class="elsevierStyleHsp" style=""></span><<span class="elsevierStyleHsp" style=""></span>1:16 by IIF in the first sample and a slight increase in sequential samples (maximum of 1:64), disappearance of IgG antibodies was observed when assayed by CL and IIF methods after treatment. However, by the IgG-WB method, it was possible to demonstrate anti-<span class="elsevierStyleItalic">T. gondii</span> IgG, which recognized the proteins p22 and p46, which were absent in the maternal serum. After 12 months of life, this child, who showed chorioretinitis scarring, remained non-reactive to anti-<span class="elsevierStyleItalic">T. gondii</span> IgG antibodies evaluated by CL and IIF; however, positivity was shown for IgG-WB.</p><p id="par0160" class="elsevierStylePara elsevierViewall">CT with non-reactivity for anti-<span class="elsevierStyleItalic">T. gondii</span> IgG and IgM may result from toxoplasmosis treatment on the mother and neonate.<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">20</span></a> The treatment of the child for a year after birth may also cause antibody non-reactivity. However, in most of these cases there is detection of anti-<span class="elsevierStyleItalic">T. gondii</span> IgG soon after treatment interruption, called the rebound effect.<a class="elsevierStyleCrossRefs" href="#bib0135"><span class="elsevierStyleSup">1,7,20</span></a></p><p id="par0165" class="elsevierStylePara elsevierViewall">In this present study, Patient 1 showed non-reactivity, but presented detectable anti-<span class="elsevierStyleItalic">T. gondii</span> antibodies after interruption of the treatment. Similarly to Patient 4, Patients 6, 8, and 9 also showed a drop in antibodies up to the point of non-reactivity and remained thus after interruption of treatment. It is possible that these patients no longer recognize the proteins p30 and p35 present in the CL test, which justifies the non-reactivity in this test with the evolution of the infection.</p><p id="par0170" class="elsevierStylePara elsevierViewall">Therefore, instead of evaluating only the persistence of anti-<span class="elsevierStyleItalic">T. gondii</span> IgG by CL, the authors suggest the use of IgG-WB in serological monitoring, since the infected child can produce antibodies against other proteins of the parasite and thus remains positive after 12 months age. In this case, the absence of anti-<span class="elsevierStyleItalic">T. gondii</span> IgG in the CL may not exclude CT, which would also justify the lower specificity of IgG-WB found during the present study compared to previous studies.<a class="elsevierStyleCrossRefs" href="#bib0210"><span class="elsevierStyleSup">16–18,22,23</span></a> However, more studies should be done before using IgG-WB in serological monitoring.</p><p id="par0175" class="elsevierStylePara elsevierViewall">According to a study carried out in a Brazilian population, patients with IgM reactive by WB method (IgM-WB) showed greater risk for active macular injury than patients with negative IgM-WB.<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">18</span></a> However, no significant difference was found between positivity of IgG-WB and the presence of macular injury, as in the present study. It is not clear whether there are specific proteins of <span class="elsevierStyleItalic">T. gondii</span> strains associated with eye injuries and if they could explain the greater frequency of eye injury on Brazilian children with CT than in other countries.<a class="elsevierStyleCrossRef" href="#bib0260"><span class="elsevierStyleSup">26</span></a> The main limitation to this present study was the absence of evaluation of the samples with IgM-WB, which could improve the diagnostic sensitivity of the test.</p><p id="par0180" class="elsevierStylePara elsevierViewall">The technical procedure for IgG-WB is of low complexity and with available cost, which makes it viable in the laboratory routine. The drawback of the in-house method is its slowness, which could be reduced with standardization of a set of reagents to be produced in Brazil. The semi-automation of the method with the use of a program for the reading of band intensity viewed though WB would facilitate the reading and the reproducibility of results.<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">20</span></a></p><p id="par0185" class="elsevierStylePara elsevierViewall">The results reinforce the usefulness of the IgG-WB method for serological evaluation of patients with CT, with greater sensitivity than the detection of anti-<span class="elsevierStyleItalic">T. gondii</span> IgM by conventional methods. Therefore, IgG-WB can be used for the early diagnosis of CT in combination with other markers of the congenital <span class="elsevierStyleItalic">T. gondii</span> infection.</p></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Funding</span><p id="par0190" class="elsevierStylePara elsevierViewall">Program of Support to the University Extension of the Ministry of Education of Brazil (PROEXT – MEC/SESu) and the National Council of Scientific and Technological Development (CNPq).</p></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Conflicts of interest</span><p id="par0195" class="elsevierStylePara elsevierViewall">The authors declare no conflicts of interest.</p></span></span>" "textoCompletoSecciones" => array:1 [ "secciones" => array:11 [ 0 => array:3 [ "identificador" => "xres758947" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Objective" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusions" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec760917" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres758948" "titulo" => "Resumo" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Objetivo" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusões" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec760916" "titulo" => "Palavras-chave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 5 => array:3 [ "identificador" => "sec0010" "titulo" => "Methods" "secciones" => array:7 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Subjects" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "Diagnostic criteria in children" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "Serological test for the detection of anti-T. gondii IgM and IgG" ] 3 => array:2 [ "identificador" => "sec0030" "titulo" => "T. gondii antigens" ] 4 => array:2 [ "identificador" => "sec0035" "titulo" => "The IgG-WB Method" ] 5 => array:2 [ "identificador" => "sec0040" "titulo" => "PCR for detection of T. gondii DNA" ] 6 => array:2 [ "identificador" => "sec0045" "titulo" => "Statistical analysis" ] ] ] 6 => array:2 [ "identificador" => "sec0050" "titulo" => "Results" ] 7 => array:2 [ "identificador" => "sec0055" "titulo" => "Discussion" ] 8 => array:2 [ "identificador" => "sec0060" "titulo" => "Funding" ] 9 => array:2 [ "identificador" => "sec0065" "titulo" => "Conflicts of interest" ] 10 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2015-10-13" "fechaAceptado" => "2016-02-16" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec760917" "palabras" => array:4 [ 0 => "Congenital Toxoplasmosis" 1 => "Western Blotting" 2 => "Diagnosis" 3 => "Serology" ] ] ] "pt" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palavras-chave" "identificador" => "xpalclavsec760916" "palabras" => array:4 [ 0 => "Toxoplasmose Congênita" 1 => "<span class="elsevierStyleItalic">Western blotting</span>" 2 => "Diagnóstico" 3 => "Sorologia" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Objective</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">To evaluate the Western blotting method for the detection of IgG anti-<span class="elsevierStyleItalic">Toxoplasma gondii</span> (<span class="elsevierStyleItalic">T. gondii</span>) (IgG-WB) in the serum of children with suspected congenital toxoplasmosis.</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Methods</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">We accompanied 47 mothers with acquired toxoplasmosis in pregnancy and their children, between June of 2011 and June of 2014. The IgG-WB was done in house and the test was considered positive if the child had antibodies that recognized at least one band on IgG blots different from the mother's or with greater intensity than the corresponding maternal band, during the first three months of life.</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">15 children (15.1%) met the criteria for congenital toxoplasmosis and 32 (32.3%) had the diagnosis excluded. The symptoms were observed in 12 (80.0%) children and the most frequent were cerebral calcification in 9 (60.0%), chorioretinitis in 8 (53.3%), and hydrocephalus in 4 (26.6%). IgM antibodies anti-<span class="elsevierStyleItalic">T. gondii</span> detected by chemiluminescence (CL) were found in 6 (40.0%) children and the polymerase chain reaction (PCR) for detection of <span class="elsevierStyleItalic">T. gondii</span> DNA was positive in 5 of 7 performed (71.4%). The sensitivity of IgG-WB was of 60.0% [95% confidence interval (CI) 32.3–83.7%] and specificity 43.7% (95% CI 26.7–62.3%). The sensitivity of IgG-WB increased to 76.0 and 89.1% when associated to the research of IgM anti-<span class="elsevierStyleItalic">T. gondii</span> or PCR, respectively.</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conclusions</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">The IgG-WB showed greater sensitivity than the detection of IgM anti-<span class="elsevierStyleItalic">T. gondii</span>; therefore, it can be used for the diagnosis of congenital toxoplasmosis in association with other congenital infection markers.</p></span>" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Objective" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusions" ] ] ] "pt" => array:3 [ "titulo" => "Resumo" "resumen" => "<span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Objetivo</span><p id="spar0075" class="elsevierStyleSimplePara elsevierViewall">Avaliar o método <span class="elsevierStyleItalic">Western Blotting</span> para detecc¸ão de IgG anti-<span class="elsevierStyleItalic">Toxoplasma gondii</span>(<span class="elsevierStyleItalic">T. gondii</span>) (IgG-WB) no soro de crianc¸as com suspeita de toxoplasmose congênita</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Métodos</span><p id="spar0080" class="elsevierStyleSimplePara elsevierViewall">Acompanhamos 47 mães com toxoplasmose adquirida na gravidez e seus filhos, entrejunho de 2011 e junho de 2014. O IgG-WB foi feito internamente e o teste foi consideradopositivo quando a crianc¸a apresentava anticorpos que reconheciam pelo menos uma bandanas manchas de IgG diferente das bandas da mãe ou com maior intensidade do que a bandamaterna correspondente, durante os primeiros 3 meses de vida</p></span> <span id="abst0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Resultados</span><p id="spar0085" class="elsevierStyleSimplePara elsevierViewall">Atenderam aos critérios para diagnóstico de toxoplasmose congênita 15crianc¸as (15,1%) e 32 (32,3%) tiveram o diagnóstico excluído. Os sintomas foram observados em12 crianc¸as (80%) e os mais frequentes foram calcificac¸ão cerebral em nove (60%), coriorretiniteem oito (53,3%) e hidrocefalia em quatro (26,6%). Os anticorpos IgM anti-<span class="elsevierStyleItalic">T. gondii</span> detectadospor quimiluminescência (QL) foram encontrados em seis crianc¸as (40%) e a reac¸ão em cadeiada polimerase (RCP) para detecc¸ão do DNA de <span class="elsevierStyleItalic">T. gondii</span> foi positiva em cinco de sete reac¸ões(71,4%). A sensibilidade do IgG-WB foi de 60% [intervalo de confianc¸a (IC) de 95%, 32,3 a 83,7%]e a especificidade foi de 43,7% (IC de 95%, 26,7 a 62,3%). A sensibilidade do IgG-WB aumentoupara 76 e 89,1% quando relacionada à pesquisa de IgM anti-<span class="elsevierStyleItalic">T. gondii</span> ou à RCP, respectivamente</p></span> <span id="abst0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Conclusões</span><p id="spar0090" class="elsevierStyleSimplePara elsevierViewall">O IgG-WB mostrou maior sensibilidade do que a detecc¸ão de IgM anti-<span class="elsevierStyleItalic">T. gondii</span>;portanto, pode ser usado para o diagnóstico de toxoplasmose congênita em associac¸ão comoutros marcadores de infecc¸ão congênita.</p></span>" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Objetivo" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusões" ] ] ] ] "NotaPie" => array:2 [ 0 => array:2 [ "etiqueta" => "☆" "nota" => "<p class="elsevierStyleNotepara" id="npar0015">Please cite this article as: Capobiango JD, Monica TC, Ferreira FP, Mitsuka-Breganó R, Navarro IT, Garcia JL, et al. Evaluation of the Western blotting method for the diagnosis of congenital toxoplasmosis. J Pediatr (Rio J). 2016;92:616–23.</p>" ] 1 => array:2 [ "etiqueta" => "☆☆" "nota" => "<p class="elsevierStyleNotepara" id="npar0020">Study conducted at Universidade Estadual de Londrina, Londrina, PR, Brazil.</p>" ] ] "multimedia" => array:4 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figure 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1715 "Ancho" => 3121 "Tamanyo" => 373364 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Pattern recognition of RH strain proteins of <span class="elsevierStyleItalic">Toxoplasma gondii</span> by IgG antibodies using the Western blotting (IgG-WB) method performed with serum samples from mothers with acquired toxoplasmosis during pregnancy and their children with suspected congenital toxoplasmosis. (A) Positive IgG-Western blotting for congenital toxoplasmosis. Equal bands recognized by IgG antibodies, with stronger intensity in the child sample compared to maternal sample. (B) Positive IgG-Western blotting for congenital toxoplasmosis. Different bands recognized by IgG from the child sample as compared to the maternal sample. (C) Negative IgG-Western blotting for congenital toxoplasmosis. Equal bands recognized by IgG antibodies from child and mother samples. M, mother; C, child; PC, positive control; NC, negative control.</p>" ] ] 1 => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1157 "Ancho" => 1527 "Tamanyo" => 82936 ] ] "descripcion" => array:1 [ "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Distribution of the most frequent <span class="elsevierStyleItalic">Toxoplasma gondii</span> proteins recognized by IgG antibodies in the serum of children with congenital toxoplasmosis and children without the disease, according to their molecular weight (kDa) (<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>><span class="elsevierStyleHsp" style=""></span>0.05 for all the recognized proteins).</p>" ] ] 2 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at1" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:3 [ "leyenda" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">PCR, polymerase chain reaction for DNA detection of <span class="elsevierStyleItalic">Toxoplasma gondii</span>; IFI, indirect immunofluorescence for detection of IgG anti-<span class="elsevierStyleItalic">T. gondii</span>; CL, microparticle chemiluminescence immunoassay for the detection of anti-<span class="elsevierStyleItalic">T. gondi</span> IgG, expressed in UI/mL; NR, unrealized; ↑, increased antibody levels of anti<span class="elsevierStyleItalic">-T. gondii</span> IgG in serial serum samples; ↔, persistence of levels of anti-<span class="elsevierStyleItalic">T. gondii</span> IgG in serum samples during follow-up; ↓, decline of antibodies.</p>" "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " rowspan="2" align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Case</th><th class="td" title="table-head " rowspan="2" align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Anti-<span class="elsevierStyleItalic">T. Gondii</span> IgM</th><th class="td" title="table-head " rowspan="2" align="left" valign="top" scope="col" style="border-bottom: 2px solid black">PCR</th><th class="td" title="table-head " colspan="2" align="center" valign="top" scope="col" style="border-bottom: 2px solid black">IgG 1st sample<a class="elsevierStyleCrossRef" href="#tblfn0005"><span class="elsevierStyleSup">a</span></a></th><th class="td" title="table-head " rowspan="2" align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Following IgG<a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">b</span></a></th><th class="td" title="table-head " rowspan="2" align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Western blotting<a class="elsevierStyleCrossRef" href="#tblfn0010"><span class="elsevierStyleSup">b</span></a></th><th class="td" title="table-head " rowspan="2" align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Signs and symptoms in the 1st month of life</th></tr><tr title="table-row"><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">IFI \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">CL \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1:512,000 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">↓ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Chorioretinitis<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>calcification<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>hydrocephalus \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1:32,000 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">926.8 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">↑ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Chorioretinitis<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>calcification \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1:512,000 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">↓ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Vitritis (chorioretinitis after)<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>calcification<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>hydrocephalus \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top"><1:16 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">↑ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Chorioretinitis \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1:1024 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">162.0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">↔ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Calcification \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">200.0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">↑ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Asymptomatic \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">7 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1:32,000 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">147.5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Hydrocephalus \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">8 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1:8000 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">312.0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">↑ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Asymptomatic \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">9 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1:512,000 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">175.6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">↓ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Asymptomatic \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">10 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1:512,000 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">188.1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">↓ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Chorioretinitis \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">11 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1:32,000 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">139.8 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Calcification \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">12 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">84.8 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">↑ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Vitritis<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>calcification \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">13 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">200.0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Chorioretinitis<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>calcification \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">14 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">173.9 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">↓ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Chorioretinitis<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>calcification<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>hydrocephalus \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">15 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Positive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">NR \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">1655.0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">↓ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Negative \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="left" valign="top">Chorioretinitis<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>calcification \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1254052.png" ] ] ] "notaPie" => array:2 [ 0 => array:3 [ "identificador" => "tblfn0005" "etiqueta" => "a" "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Sample collected in the 1st month of life.</p>" ] 1 => array:3 [ "identificador" => "tblfn0010" "etiqueta" => "b" "nota" => "<p class="elsevierStyleNotepara" id="npar0010">Sample collected within the first 3 months of life, with all children in treatment.</p>" ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Clinical and laboratory characteristics of 15 children with congenital toxoplasmosis, from June 2011 to June 2014.</p>" ] ] 3 => array:8 [ "identificador" => "tbl0010" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at2" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "leyenda" => "<p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">IgG-WB, Western blotting for diagnosis of congenital infection with detection of IgG antibodies; anti-<span class="elsevierStyleItalic">Toxoplasma gondii</span> IgM detected by chemiluminescence; Symptoms, presence of symptoms and/or clinical signs consistent with congenital toxoplasmosis; +, positive test.</p>" "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Test \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Sensitivity (%) \t\t\t\t\t\t\n \t\t\t\t</th><th class="td" title="table-head " align="left" valign="top" scope="col" style="border-bottom: 2px solid black">Specificity (%) \t\t\t\t\t\t\n \t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">IgG-WB+ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">60.0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">43.7 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">IgM <span class="elsevierStyleItalic">T. gondii</span>+ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">40.0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">100.0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">IgM anti-<span class="elsevierStyleItalic">T. gondii</span> or IgG-WB+ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">76.0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">43.7 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">IgM anti<span class="elsevierStyleItalic">-T. gondii</span> and IgG-WB+ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">24.0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">100.0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">PCR+ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">71.7 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">100.0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">PCR<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>or IgG-WB+ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">89.1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">43.7 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">PCR<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>and IgG-WB+ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">42.6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">100.0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Symptoms+ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">80.0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">100.0 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Symptoms<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>or IgG-WB+ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">92.0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">43.7 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="table-entry ; entry_with_role_rowhead " align="left" valign="top">Symptoms<span class="elsevierStyleHsp" style=""></span>+<span class="elsevierStyleHsp" style=""></span>and IgG-WB+ \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">48.0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="table-entry " align="char" valign="top">100.0 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab1254053.png" ] ] ] ] "descripcion" => array:1 [ "en" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Sensitivity and specificity of the Western blotting method for the detection of anti-<span class="elsevierStyleItalic">Toxoplasma gondii</span> IgG (IgG-WB), anti-<span class="elsevierStyleItalic">Toxoplasma gondii</span> IgM test, the polymerase chain reaction (PCR) to <span class="elsevierStyleItalic">Toxoplasma gondii</span>, and the presence of clinical symptoms compatible with congenital toxoplasmosis, assessed in series and in parallel, according to the presence or absence of congenital toxoplasmosis.</p>" ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0005" "bibliografiaReferencia" => array:26 [ 0 => array:3 [ "identificador" => "bib0135" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Toxoplasmosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "J.S. Remington" 1 => "R. McLeod" 2 => "C.B. Wilson" 3 => "G. Desmonts" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "LibroEditado" => array:5 [ "titulo" => "Infectious disease of the fetus and newborn infant" "paginaInicial" => "918" "paginaFinal" => "1041" "edicion" => "7 ed." "serieFecha" => "2011" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0140" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Report of committee on infectious diseases. <span class="elsevierStyleItalic">Toxoplasma gondii</span> infections (Toxoplasmosis)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "American Academy of Pediatrics" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:7 [ "edicion" => "28 ed." "titulo" => "American academy of pediatrics. Red book" "fecha" => "2009" "paginaInicial" => "667" "paginaFinal" => "672" "editorial" => "Elk Grove Village" "editorialLocalizacion" => "Illinois" ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0145" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Feasibility of neonatal screening for toxoplasma infection in the absence of prenatal treatment. Danish Congenital Toxoplasmosis Study Group" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Lebech" 1 => "O. Andersen" 2 => "N.C. Christensen" 3 => "J. Hertel" 4 => "H.E. Nielsen" 5 => "B. Peitersen" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Lancet" "fecha" => "1999" "volumen" => "353" "paginaInicial" => "1834" "paginaFinal" => "1837" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10359408" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0150" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Congenital toxoplasmosis: late pregnancy infections detected by neonatal screening and maternal serological testing at delivery" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "E.G. Lago" 1 => "E.C. Neto" 2 => "J. Melamed" 3 => "A.P. Rucks" 4 => "C. Presotto" 5 => "J.C. Coelho" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1365-3016.2007.00869.x" "Revista" => array:6 [ "tituloSerie" => "Paediatr Perinat Epidemiol" "fecha" => "2007" "volumen" => "21" "paginaInicial" => "525" "paginaFinal" => "531" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17937738" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0155" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Congenital toxoplasmosis in a reference center of Paraná, Southern Brazil" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.D. Capobiango" 1 => "R. Mitsuka-Breganó" 2 => "I.T. Navarro" 3 => "C.P. Rezende Neto" 4 => "A.M. Casella" 5 => "F.M. Lopes-Mori" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.bjid.2013.11.009" "Revista" => array:6 [ "tituloSerie" => "Braz J Infect Dis" "fecha" => "2014" "volumen" => "18" "paginaInicial" => "364" "paginaFinal" => "371" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24662141" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0160" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Congenital toxoplasmosis: evaluation of serological methods for detection of anti-<span class="elsevierStyleItalic">Toxoplasma gondii</span> IgM and IgA antibodies" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "I.M. Rodrigues" 1 => "A.M. Castro" 2 => "M.B. Gomes" 3 => "W.N. Amaral" 4 => "M.M. Avelino" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Mem Inst Oswaldo Cruz" "fecha" => "2009" "volumen" => "104" "paginaInicial" => "434" "paginaFinal" => "440" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19547868" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0165" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Strategy for diagnosis of congenital toxoplasmosis: evaluation of methods comparing mothers and newborns and standard methods for postnatal detection of immunoglobulin G, M and A antibodies" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.M. Pinon" 1 => "H. Dumon" 2 => "C. Chemla" 3 => "J. Franck" 4 => "E. Petersen" 5 => "M. Lebech" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/JCM.39.6.2267-2271.2001" "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "2001" "volumen" => "39" "paginaInicial" => "2267" "paginaFinal" => "2271" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11376068" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0170" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Usefulness of Western Blot in serological follow-up of newborns suspected of congenital toxoplasmosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "D. Tissot-Dupont" 1 => "H.H. Fricker" 2 => "M.P. Pinchart" 3 => "C. Bost-Bru" 4 => "P.A. Thomas" 5 => "H. Pelloux" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s10096-003-0887-5" "Revista" => array:6 [ "tituloSerie" => "Eur J Clin Microbiol Infect Dis" "fecha" => "2003" "volumen" => "22" "paginaInicial" => "122" "paginaFinal" => "125" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12627289" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0175" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Recent developments for diagnosis of toxoplasmosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "J.S. Remington" 1 => "P. Thulliez" 2 => "J.G. Montoya" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "2004" "volumen" => "42" "paginaInicial" => "941" "paginaFinal" => "945" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15004036" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0180" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Atenção à saúde do recém-nascido: guia para os profissionais de saúde: intervenções comuns, icterícia e infecções" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "Brasil. Ministério da Saúde. Secretaria de Atenção à Saúde. Departamento de Ações Programáticas Estratégicas" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:6 [ "edicion" => "2 ed." "fecha" => "2013" "paginaInicial" => "109" "paginaFinal" => "122" "editorial" => "Ministério da Saúde" "editorialLocalizacion" => "Brasília" ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0185" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Classification system and case definitions of <span class="elsevierStyleItalic">Toxoplasma</span> infection in immunocompetent pregnant women and their congenitally infected offspring" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Lebech" 1 => "D.H. Joynson" 2 => "H.M. Seitz" 3 => "P. Thulliez" 4 => "R.E. Gilbert" 5 => "G.N. Dutton" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Eur J Clin Microbiol Infect Dis" "fecha" => "1996" "volumen" => "15" "paginaInicial" => "799" "paginaFinal" => "805" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8950557" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0190" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Improved technique of indirect immunofluorescence for serological diagnosis of toxoplasmosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "M.E. Camargo" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Rev Inst Med Trop Sao Paulo" "fecha" => "1964" "volumen" => "6" "paginaInicial" => "117" "paginaFinal" => "118" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14177810" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0195" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Immune responses in sheep after immunization with <span class="elsevierStyleItalic">Toxoplasma gondii</span> antigens incorporated into iscoms" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "A. Lundén" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Vet Parasitol" "fecha" => "1995" "volumen" => "56" "paginaInicial" => "23" "paginaFinal" => "25" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7732647" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0200" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Protein measurement with the Folin phenol reagent" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "O.H. Lowry" 1 => "N.J. Rosebrough" 2 => "A.L. Farr" 3 => "R.J. Randall" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Biol Chem" "fecha" => "1951" "volumen" => "193" "paginaInicial" => "265" "paginaFinal" => "275" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14907713" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0205" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Diagnosis of congenital toxoplasmosis by immunoblotting and relationship with other methods" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "B.F. Chumpitazi" 1 => "A. Boussaid" 2 => "H. Pelloux" 3 => "C. Racinet" 4 => "M. Bost" 5 => "A.G. Fleuret" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "1995" "volumen" => "33" "paginaInicial" => "1479" "paginaFinal" => "1485" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7650171" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0210" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Comparative immunoglobulin G antibody profiles between mother and child (CGMC Test) for early diagnosis of congenital toxoplasmosis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "U. Gross" 1 => "C.G. Lüder" 2 => "V. Hendgen" 3 => "C. Heeg" 4 => "I. Sauer" 5 => "A. Weidner" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "J Clin Microbiol" "fecha" => "2000" "volumen" => "38" "paginaInicial" => "3619" "paginaFinal" => "3622" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11015373" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0215" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Evaluation of a commercial IgG/IgM western blot assay for early postnatal diagnosis of congenital toxoplasmosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "V. Rilling" 1 => "K. Dietz" 2 => "D. Krczal" 3 => "F. Knotek" 4 => "G. Enders" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s10096-003-0906-6" "Revista" => array:6 [ "tituloSerie" => "Eur J Clin Microbiol Infect Dis" "fecha" => "2003" "volumen" => "22" "paginaInicial" => "174" "paginaFinal" => "180" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12649715" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0220" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "IgG and IgM western blot assay for diagnosis of congenital toxoplasmosis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A.S. Machado" 1 => "G.M. Andrade" 2 => "J.N. Januário" 3 => "M.D. Fernandes" 4 => "A.C. Carneiro" 5 => "M. Carneiro" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Mem Inst Oswaldo Cruz" "fecha" => "2010" "volumen" => "105" "paginaInicial" => "757" "paginaFinal" => "761" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20944989" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0225" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Identification of a 200- to 300-fold repetitive 529<span class="elsevierStyleHsp" style=""></span>bp DNA fragment in <span class="elsevierStyleItalic">Toxoplasma gondii</span>, and its use for diagnostic and quantitative PCR" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "W.L. Homan" 1 => "M. Vercammen" 2 => "J. De Braekeleer" 3 => "H. Verschueren" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Int J Parasitol" "fecha" => "2000" "volumen" => "30" "paginaInicial" => "69" "paginaFinal" => "75" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10675747" "web" => "Medline" ] ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0230" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "<span class="elsevierStyleItalic">Toxoplasma gondii</span> infection in pregnancy: opportunities and pitfalls of serological diagnosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "A. Sensini" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1111/j.1469-0691.2006.01444.x" "Revista" => array:6 [ "tituloSerie" => "Clin Microbiol Infect" "fecha" => "2006" "volumen" => "12" "paginaInicial" => "504" "paginaFinal" => "512" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16700697" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0235" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Presence and duration of anti-<span class="elsevierStyleItalic">Toxoplasma gondii</span> immunoglobulin M in infants with congenital toxoplasmosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "E.G. Lago" 1 => "A.P. Oliveira" 2 => "A.L. Bender" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Pediatr (Rio J)" "fecha" => "2014" "volumen" => "90" "paginaInicial" => "363" "paginaFinal" => "369" ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0240" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Western blotting for the diagnosis of congenital toxoplasmosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "B. Magi" 1 => "L. Migliorini" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "New Microbiol" "fecha" => "2011" "volumen" => "34" "paginaInicial" => "93" "paginaFinal" => "95" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21344152" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0245" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Comparison of mother and child antibodies that target high-molecular-mass <span class="elsevierStyleItalic">Toxoplasma gondii</span> antigens by immunoblotting improves neonatal diagnosis of congenital toxoplasmosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "C. L’Ollivier" 1 => "M. Wallon" 2 => "B. Faucher" 3 => "R. Piarroux" 4 => "F. Peyron" 5 => "J. Franck" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1128/CVI.00060-12" "Revista" => array:6 [ "tituloSerie" => "Clin Vaccine Immunol" "fecha" => "2012" "volumen" => "19" "paginaInicial" => "1326" "paginaFinal" => "1328" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22695159" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0250" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Performance of a Western Blot assay to compare mother and newborn anti-<span class="elsevierStyleItalic">Toxoplasma gondii</span> antibodies for the early neonatal diagnosis of congenital toxoplasmosis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "F.R. Gamgneux" 1 => "V. Commere" 2 => "C.T. Schaefer" 3 => "J.D. Camet" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Eur J Clin Microbiol Infect Dis" "fecha" => "1999" "volumen" => "18" "paginaInicial" => "648" "paginaFinal" => "654" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10534187" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0255" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A comparative study of <span class="elsevierStyleItalic">Toxoplasma gondii</span> seroprevalence in three healthy Chinese populations detected using native and recombinant antigens" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "X. Sun" 1 => "H. Lu" 2 => "B. Jia" 3 => "Z. Chang" 4 => "S. Peng" 5 => "J. Yin" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/1756-3305-6-241" "Revista" => array:6 [ "tituloSerie" => "Parasit Vectors" "fecha" => "2013" "volumen" => "6" "paginaInicial" => "241" "paginaFinal" => "247" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23958280" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0260" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "European Multicentre Study on Congenital Toxoplasmosis (EMSCOT). Ocular sequelae of congenital toxoplasmosis in Brazil compared with Europe" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "R.E. Gilbert" 1 => "K. Freeman" 2 => "E.G. Lago" 3 => "L.M. Bahia-Oliveira" 4 => "H.K. Tan" 5 => "M. Wallon" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "PLoS Negl Trop Dis" "fecha" => "2008" "volumen" => "2" "numero" => "e277" "paginaInicial" => "1" "paginaFinal" => "7" ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:3 [ "titulo" => "Acknowledgments" "texto" => "<p id="par0200" class="elsevierStylePara elsevierViewall">To all the patients and family members who contributed to the fulfillment of this work, to the Postgraduate Program in Health Sciences of the Universidade Estadual de Londrina (UEL), and to the Postgraduate Program in Animal Sciences of the UEL.</p>" "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/00217557/0000009200000006/v1_201611170050/S0021755716300973/v1_201611170050/en/main.assets" "Apartado" => array:4 [ "identificador" => "10179" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Original articles" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/00217557/0000009200000006/v1_201611170050/S0021755716300973/v1_201611170050/en/main.pdf?idApp=UINPBA000049&text.app=https://jped.elsevier.es/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0021755716300973?idApp=UINPBA000049" ]
Year/Month | Html | Total | |
---|---|---|---|
2024 November | 4 | 2 | 6 |
2024 October | 19 | 25 | 44 |
2024 September | 24 | 28 | 52 |
2024 August | 45 | 56 | 101 |
2024 July | 49 | 46 | 95 |
2024 June | 28 | 19 | 47 |
2024 May | 24 | 15 | 39 |
2024 April | 26 | 23 | 49 |
2024 March | 30 | 24 | 54 |
2024 February | 33 | 19 | 52 |
2024 January | 17 | 26 | 43 |
2023 December | 20 | 25 | 45 |
2023 November | 30 | 26 | 56 |
2023 October | 36 | 32 | 68 |
2023 September | 21 | 38 | 59 |
2023 August | 16 | 16 | 32 |
2023 July | 21 | 21 | 42 |
2023 June | 24 | 19 | 43 |
2023 May | 26 | 22 | 48 |
2023 April | 21 | 11 | 32 |
2023 March | 30 | 19 | 49 |
2023 February | 31 | 18 | 49 |
2023 January | 30 | 14 | 44 |
2022 December | 49 | 26 | 75 |
2022 November | 40 | 25 | 65 |
2022 October | 50 | 30 | 80 |
2022 September | 30 | 24 | 54 |
2022 August | 32 | 24 | 56 |
2022 July | 29 | 33 | 62 |
2022 June | 28 | 30 | 58 |
2022 May | 40 | 28 | 68 |
2022 April | 39 | 34 | 73 |
2022 March | 52 | 43 | 95 |
2022 February | 21 | 21 | 42 |
2022 January | 24 | 23 | 47 |
2021 December | 12 | 19 | 31 |
2021 November | 10 | 15 | 25 |
2021 October | 16 | 25 | 41 |
2021 September | 11 | 13 | 24 |
2021 August | 9 | 9 | 18 |
2021 July | 8 | 6 | 14 |
2021 June | 25 | 6 | 31 |
2021 May | 21 | 15 | 36 |
2021 April | 26 | 28 | 54 |
2021 March | 37 | 11 | 48 |
2021 February | 17 | 13 | 30 |
2021 January | 21 | 10 | 31 |
2020 December | 24 | 12 | 36 |
2020 November | 21 | 15 | 36 |
2020 October | 15 | 8 | 23 |
2020 September | 26 | 12 | 38 |
2020 August | 25 | 8 | 33 |
2020 July | 16 | 7 | 23 |
2020 June | 9 | 6 | 15 |
2020 May | 23 | 18 | 41 |
2020 April | 22 | 15 | 37 |
2020 March | 5 | 2 | 7 |
2020 February | 24 | 10 | 34 |
2020 January | 22 | 14 | 36 |
2019 December | 8 | 14 | 22 |
2019 November | 9 | 6 | 15 |
2019 October | 14 | 18 | 32 |
2019 September | 16 | 8 | 24 |
2019 August | 11 | 10 | 21 |
2019 July | 15 | 11 | 26 |
2019 June | 17 | 18 | 35 |
2019 May | 8 | 12 | 20 |
2019 April | 25 | 12 | 37 |
2019 March | 15 | 9 | 24 |
2019 February | 12 | 10 | 22 |
2019 January | 15 | 11 | 26 |
2018 December | 20 | 13 | 33 |
2018 November | 50 | 6 | 56 |
2018 October | 163 | 15 | 178 |
2018 September | 67 | 16 | 83 |
2018 August | 30 | 13 | 43 |
2018 July | 44 | 12 | 56 |
2018 June | 40 | 8 | 48 |
2018 May | 77 | 11 | 88 |
2018 April | 8 | 3 | 11 |
2018 March | 13 | 4 | 17 |
2018 February | 13 | 0 | 13 |
2018 January | 16 | 1 | 17 |
2017 December | 8 | 1 | 9 |
2017 November | 26 | 3 | 29 |
2017 October | 22 | 4 | 26 |
2017 September | 12 | 1 | 13 |
2017 August | 15 | 4 | 19 |
2017 July | 23 | 3 | 26 |
2017 June | 15 | 9 | 24 |
2017 May | 19 | 2 | 21 |
2017 April | 18 | 30 | 48 |
2017 March | 11 | 12 | 23 |
2017 February | 9 | 4 | 13 |
2017 January | 13 | 13 | 26 |
2016 December | 24 | 29 | 53 |
2016 November | 16 | 21 | 37 |
2016 October | 1 | 14 | 15 |
2016 September | 5 | 6 | 11 |
2016 August | 12 | 8 | 20 |