Compartilhar
Informação da revista
Vol. 92. Núm. 6.
Páginas 616-623 (Novembro - Dezembro 2016)
Compartilhar
Compartilhar
Baixar PDF
Mais opções do artigo
Visitas
...
Vol. 92. Núm. 6.
Páginas 616-623 (Novembro - Dezembro 2016)
Artigo Original
DOI: 10.1016/j.jpedp.2016.08.005
Open Access
Evaluation of the Western blotting method for the diagnosis of congenital toxoplasmosis
Avaliação do método Western Blotting para diagnóstico de toxoplasmose congênita
Visitas
...
Jaqueline Dario Capobiangoa,
Autor para correspondência
jaquedc@uel.br

Autor para correspondência.
, Thaís Cabral Monicab, Fernanda Pinto Ferreirac, Regina Mitsuka‐Breganód, Italmar Teodorico Navarrod, João Luis Garciad, Edna Maria Vissoci Reichee
a Universidade Estadual de Londrina (UEL), Centro de Ciências da Saúde, Departamento de Pediatria e Cirurgia Pediátrica, Londrina, PR, Brasil
b Universidade Estadual de Londrina (UEL), Centro de Ciências Agrárias, Programa de Pós‐graduação em Ciência Animal, Londrina, PR, Brasil
c Universidade Estadual de Londrina (UEL), Departamento de Medicina Veterinária Preventiva, Laboratório de Zoonoses e Saúde Pública, Londrina, PR, Brasil
d Universidade Estadual de Londrina (UEL), Centro de Ciências Agrárias, Departamento de Medicina Veterinária Preventiva, Londrina, PR, Brasil
e Universidade Estadual de Londrina (UEL), Departamento de Patologia, Análises Clínicas e Toxicológicas, Londrina, PR, Brasil
Informação do artigo
Resume
Texto Completo
Bibliografia
Baixar PDF
Estatísticas
Figuras (2)
Tabelas (2)
Tabela 1. Características clínicas e laboratoriais de 15 crianças com toxoplasmose congênita de junho de 2011 a junho de 2014
Tabela 2. Sensibilidade e especificidade do método Western Blotting para detecção de IgG anti‐Toxoplasma gondii (IgG‐WB), IgM anti‐Toxoplasma gondii, reação em cadeia da polimerase (RCP) ao Toxoplasma gondii e presença de sintomas clínicos compatíveis com a toxoplasmose congênita, avaliados em série e paralelamente, de acordo com a presença ou ausência de toxoplasmose congênita
Mostrar maisMostrar menos
Abstract
Objective

To evaluate the Western blotting method for the detection of IgG anti‐Toxoplasma gondii (T. gondii) (IgG‐WB) in the serum of children with suspected congenital toxoplasmosis.

Methods

We accompanied 47 mothers with acquired toxoplasmosis in pregnancy and their children, between June of 2011 and June of 2014. The IgG‐WB was done in house and the test was considered positive if the child had antibodies that recognized at least one band on IgG blots different from the mother's or with greater intensity than the corresponding maternal band, during the first three months of life.

Results

15 children (15.1%) met the criteria for congenital toxoplasmosis and 32 (32.3%) had the diagnosis excluded. The symptoms were observed in 12 (80.0%) children and the most frequent were cerebral calcification in 9 (60.0%), chorioretinitis in 8 (53.3%), and hydrocephalus in 4 (26.6%). IgM antibodies anti‐T. gondii detected by chemiluminescence (CL) were found in 6 (40.0%) children and the polymerase chain reaction (PCR) for detection of T. gondii DNA was positive in 5 of 7 performed (71.4%). The sensitivity of IgG‐WB was of 60.0% [95% confidence interval (CI) 32.3–83.7%] and specificity 43.7% (95% CI 26.7–62.3%). The sensitivity of IgG‐WB increased to 76.0 and 89.1% when associated to the research of IgM anti‐T. gondii or PCR, respectively.

Conclusions

The IgG‐WB showed greater sensitivity than the detection of IgM anti‐T. gondii; therefore, it can be used for the diagnosis of congenital toxoplasmosis in association with other congenital infection markers.

Keywords:
Congenital Toxoplasmosis
Western Blotting
Diagnosis
Serology
Resumo
Objetivo

Avaliar o método Western Blotting para detecção de IgG anti‐Toxoplasma gondii (T. gondii) (IgG‐WB) no soro de crianças com suspeita de toxoplasmose congênita.

Métodos

Acompanhamos 47 mães com toxoplasmose adquirida na gravidez e seus filhos, entre junho de 2011 e junho de 2014. O IgG‐WB foi feito internamente e o teste foi considerado positivo quando a criança apresentava anticorpos que reconheciam pelo menos uma banda nas manchas de IgG diferente das bandas da mãe ou com maior intensidade do que a banda materna correspondente, durante os primeiros 3 meses de vida.

Resultados

Atenderam aos critérios para diagnóstico de toxoplasmose congênita 15 crianças (15,1%) e 32 (32,3%) tiveram o diagnóstico excluído. Os sintomas foram observados em 12 crianças (80%) e os mais frequentes foram calcificação cerebral em nove (60%), coriorretinite em oito (53,3%) e hidrocefalia em quatro (26,6%). Os anticorpos IgM anti‐T. gondii detectados por quimiluminescência (QL) foram encontrados em seis crianças (40%) e a reação em cadeia da polimerase (RCP) para detecção do DNA de T. gondii foi positiva em cinco de sete reações (71,4%). A sensibilidade do IgG‐WB foi de 60% [intervalo de confiança (IC) de 95%, 32,3 a 83,7%] e a especificidade foi de 43,7% (IC de 95%, 26,7 a 62,3%). A sensibilidade do IgG‐WB aumentou para 76 e 89,1% quando relacionada à pesquisa de IgM anti‐T. gondii ou à RCP, respectivamente.

Conclusões

O IgG‐WB mostrou maior sensibilidade do que a detecção de IgM anti‐T. gondii; portanto, pode ser usado para o diagnóstico de toxoplasmose congênita em associação com outros marcadores de infecção congênita.

Palavras‐chave:
Toxoplasmose Congênita
Western blotting
Diagnóstico
Sorologia
Texto Completo
Introdução

A maioria das crianças com toxoplasmose congênita (TC) não demonstra sinais ou sintomas no nascimento. Ainda assim, há um risco de desenvolver sequelas tardias, principalmente comprometimento ocular e neurológico.1

Todas as crianças cujas mães tiveram toxoplasmose aguda no curso da gravidez são consideradas suspeitas; portanto, devem ser submetidas a uma investigação sorológica com detecção de anticorpos anti‐Toxoplasma gondii (T. gondii).1,2

Contudo, um diagnóstico sorológico que confirme a infecção por T. gondii por meio da detecção de anticorpos específicos IgM e/ou IgA contra o parasita não ocorre em todos os recém‐nascidos.1,3–5 Portanto, os anticorpos IgG contra o T. gondii em amostras de soro em série devem ser analisados e a criança deve continuar sob acompanhamento ambulatorial, que pode levar meses até a definição do diagnóstico.1,6

Em um feto infectado, os anticorpos IgG e IgM produzidos contra os determinantes antigênicos de T. gondii poderão diferir dos anticorpos IgG e IgM anti‐T. gondii detectados no soro materno, o que sugere uma neossíntese de anticorpos específicos. Assim, crianças com TC com não reatividade em testes convencionais para detecção de IgM foram diagnosticadas nos primeiros meses de vida por meio do método Western Blot (WB).7–9

Existe a necessidade de um diagnóstico precoce e rápido com um método de baixa complexidade que permita que os laboratórios de referência em toxoplasmose diferenciem os resultados duvidosos obtidos com os métodos sorológicos convencionais de rotina, como imunofluorescência indireta (IFI), ensaio imunossorvente ligado a enzima (Elisa) e imunoensaio de micropartículas com quimiluminescência (QL).

O objetivo deste estudo foi avaliar o método WB para detecção de anticorpos IgG anti‐T. gondii (IgG‐WB) no soro da criança e de sua mãe com toxoplasmose adquirida na gravidez para ajudar no diagnóstico precoce de TC.

MétodosIndivíduos

A população era composta de mulheres com suspeita de toxoplasmose adquirida na gravidez e seus filhos, tratados no Ambulatório Pediátrico de Doenças Infecciosas, entre junho de 2011 e junho de 2014. Incluímos crianças cujas mães demonstraram reatividade ao IgM anti‐T Gondii durante o cuidado pré‐natal. As amostras de sangue dos pares criança/mãe foram coletadas simultaneamente durante os primeiros 3 meses de vida da criança e armazenadas a –20°C para o WB. O grupo de controle consistia em crianças cujas mães mostraram suspeita de toxoplasmose aguda durante a gravidez, mas não atendiam aos critérios para TC.2,10,11 Nesse período, 47 crianças e suas mães foram monitoradas. Dessas, 15 (15,1%) crianças foram diagnosticadas com TC e em 32 (32,3%) esse diagnóstico foi excluído. As grávidas receberam espiramicina ou sulfadiazina mais pirimetamina e ácido folínico até o nascimento da criança. As crianças com suspeita de infecção receberam sulfadiazina mais pirimetamina e ácido folínico até a definição do diagnóstico.

Critérios de diagnóstico em crianças

Consideramos a TC quando a criança apresentou elevação de títulos específicos de IgG anti‐T. gondii em amostras sequenciais nos primeiros meses de sua vida e/ou a persistência de títulos de IgG anti‐T. gondii após 12 meses de vida e/ou reatividade para IgM anti‐T. gondii e/ou coriorretinite e/ou lesão do sistema nervoso central (SNC) com reatividade para IgG e/ou positividade para o DNA de T. gondii com reação em cadeia da polimerase (RCP).2,10,11

Teste sorológico para detecção de IgM e IgG anti‐T. gondii

Os testes sorológicos durante o cuidado pré‐natal e em amostras de crianças foram feitos por métodos laboratoriais de rotina convencionais. Os anticorpos IgG anti‐T. gondii foram determinados por imunofluorescência indireta (IFI)12 (Immunoblot, Biolab‐Mérieux, Rio de Janeiro, RJ, Brasil), com T. gondii obtidos do fluido ascético de ratos infectados, e quimioluminescência (QL) (Architect, Sistema Abbott, Wiesbaden, Alemanha) com antígenos recombinantes de T. gondii p30 (SAG1) e p35 (GRA8). Os anticorpos IgM anti‐T. gondii também foram detectados com QL (Architect, Sistema Abbott, Wiesbaden, Alemanha) com antígeno p30 e lisado total de T. gondii.

Antígenos de T. gondii

Cinco ratas albinas entre 45 e 60 dias e entre 25 e 40g foram usadas na obtenção de taquizoítos da cepa RH de T. gondii. Os animais foram inoculados pela via intraperitoneal com uma suspensão de taquizoítos vivos (105/mL) em uma solução salina estéril. O exsudato foi obtido 48 horas após a inoculação por meio da lavagem da cavidade peritoneal com 3mL de solução salina estéril. As amostras passaram por uma agulha 27G para ruptura das células do hospedeiro. Então, foram centrifugadas e o sedimento foi padronizado a 109 taquizoítos/mL por meio da contagem em uma câmara de Neubauer.13

Método IgG‐Western blotting

As proteínas de T. gondii a serem usadas no IgG‐WB foram quantificadas com o método de Lowry et al.14 e o gel de poliacrilamida 12% foi usado na separação eletroforética de proteínas com a transferência subsequente das proteínas para uma membrana de nitrocelulose (iBlot® Gel Transfer System, Califórnia, EUA). O papel de nitrocelulose foi manchado com Ponceau e, após lavagem com água destilada, as tiras de nitrocelulose foram cortadas e bloqueadas com leite desnatado a 5% mais Tween® salina tamponada com Tris (TBS) (Sigma‐Aldrich, MO, EUA). Posteriormente, lavamos as tiras com TBS e leite desnatado a 5% e, então, adicionamos o soro do paciente diluído em Tween TBS (Sigma‐Aldrich, MO, EUA) e leite desnatado a 5%, lavamos e adicionamos conjugado IgG anti‐humano (Invitrogen, Life Technologies, CA, EUA) diluído em Tween TBS e leite desnatado a 5%. Após lavagens adicionais, adicionamos o substrato cromogênico diaminobenzidina (DAB) a 0,2% (Acrös Organics, Thermo Fisher Scientific, Geel, Bélgica) e peróxido de hidrogênio (100μL). Quando as bandas foram visualizadas, a reação foi interrompida com água destilada. As amostras de controle positivo e negativo de anti‐T. gondii foram incluídas em cada teste.

O teste foi considerado positivo no caso de a criança ter produzido anticorpos que reconheceram no mínimo uma banda de proteínas diferente da mãe ou com maior intensidade do que a banda materna correspondente (fig. 1), o que caracterizou a neossíntese de anticorpos IgG anti‐T. gondii.15–18 Para controlar a subjetividade da leitura, dois observadores independentes leram os padrões do IgG‐WB às cegas e sem o conhecimento dos resultados sorológicos anteriores dos testes convencionais; houve concordância em 100% dos resultados.

Figura 1.

Reconhecimento padrão de proteínas de cepas RH de Toxoplasma gondii por anticorpos IgG com o método Western Blotting (IgG‐WB) em amostras de soro de mães com toxoplasmose adquirida durante a gravidez e seus filhos com suspeita de toxoplasmose congênita. A, IgG‐Western Blotting positivo para toxoplasmose congênita. Bandas iguais reconhecidas por anticorpos IgG com intensidade mais forte na amostra da criança em comparação com a amostra materna. B, IgG‐Western Blotting positivo para toxoplasmose congênita. Bandas diferentes reconhecidas por IgG da amostra da criança em comparação com a amostra materna. C, IgG‐Western Blotting negativo para toxoplasmose congênita. Bandas iguais reconhecidas por anticorpos IgG de amostras da criança e da mãe. M, mãe; C, criança; CP, controle positivo; CN, controle negativo.

(0,35MB).

A especificidade do método IgG‐WB foi determinada com 26 amostras séricas obtidas de indivíduos soronegativos para toxoplasmose (anticorpos IgG e IgM anti‐T. gondii não reativos com QL) e com sororreatividade a anticorpos com relação a outros patógenos, como Treponema pallidum (n=5), Trypanosoma cruzi (n=5), Leishmania spp (n=2), Paracoccidioides brasilienses (n=5) ou sororreatividade a marcadores sorológicos de doenças autoimunes, como anticorpos antinucleares (n=5) e anticorpos anti‐DNA de cadeia dupla (n=4).

Uso da reação em cadeia da polimerase para detecção do DNA de T. gondii

O DNA foi extraído de células sanguíneas periféricas de crianças, coletado com o etilenodiaminotetracético (EDTA) como anticoagulante, até três meses após o nascimento, com o kit EasyPrep DNA Mini I (EasyGen, Favorgen Biotech, Áustria). A amplificação do DNA de T. gondii foi feita com o método descrito por Homan et al.19 Os Primers Tox4 (CGCTGCAGGGAGGAAGACGAAAGTTG) e Tox5 (CGCTGCAGACACAGTGCATCTGGATT) foram usados para amplificação de um fragmento de 529 pares de base (pb) (GenBank n° AFI46527) do DNA de T. gondii. A RCP foi feita em um volume final de 22,5μL, com 2,5μL de DNA extraído da amostra; 1μL de 1mM para cada primer, 100mM de desoxirribonucleotídeos fosfatados (dNTP) (Invitrogen, Life Technologies, CA, EUA), 60mM de Tris‐HCl (pH 9), 15mM de (NH4)2SO4, 2mM de MgCl2 e 0,25μL de Taq DNA polimerase (Invitrogen, Life Technologies, CAa, EUA), também finalizada com 7,75μL de água Milli Q. A amplificação foi feita com 35 ciclos em um termociclador PTC‐100 (MJ Research, CA, EUA), com a seguinte condição de ciclo: 7 minutos a 94°C para desnaturação no 1° ciclo, seguido de 33 ciclos de 1 minuto a 94°C para desnaturação, 1 minuto a 55°C para emparelhamento e 1 minuto a 72°C para extensão; o ciclo 35 foi seguido por uma extensão final de 10 minutos a 72°C. Uma amostra de cada produto da RCP foi submetida à eletroforese em gel de agarose a 2%. O DNA de cepas RH de taquizoítos (107/mL) foi extraído para ser usado como controle positivo. A água foi considerada o controle negativo. Amostras dos controles positivos e negativos para T. gondii foram incluídas em cada teste.

Análise estatística

Foi feita no GraphPad Prism 5 (GraphPad Software, Inc., San Diego, EUA). As variáveis categóricas foram expressas em um número absoluto (n) e um percentual (%) e analisadas pelo teste qui‐quadrado ou exato de Fisher. Foram calculados parâmetros de sensibilidade, especificidade, valor preditivo positivo (VPP) e valor preditivo negativo (VPN) com intervalo de confiança (IC) de 95%. Os valores de p<0,05 foram considerados estatisticamente significativos.

O estudo foi aprovado pelo Comitê de Ética em Pesquisa com Seres Humanos. Todas as mães participaram voluntariamente e assinaram o Termo de Consentimento Livre e Esclarecido.

Resultados

Das 15 crianças com TC, 12 (80%) eram sintomáticas e atendiam aos critérios clínicos para definição da doença (nove com calcificação cerebral, oito com coriorretinite e quatro com hidrocefalia), seis (40%) apresentaram reatividade a IgM anti‐T. gondii, cinco (33,3%) apresentaram elevação nos níveis de IgG anti‐T. gondii nos primeiros meses de vida e uma delas (6,7%) mostrou persistência de títulos de IgG anti‐T. gondii em amostras sequenciais. Cinco das sete crianças (71,4%) submetidas à PCR para detectar DNA de T. gondii apresentaram resultados positivos (tabela 1).

Tabela 1.

Características clínicas e laboratoriais de 15 crianças com toxoplasmose congênita de junho de 2011 a junho de 2014

CasoIgM
anti‐T. gondii
RCPPrimeira amostra de IgGaIgG seguintesb  Western Blottingb  Sinais e sintomas no 1° mês de vida 
IFI  QL       
Negativo  NR  1:512.000  NR  ↓  Negativo  coriorretinite+calcificação+hidrocefalia 
Positivo  NR  1:32.000  926,8  ↑  Positivo  coriorretinite+calcificação 
Positivo  NR  1:512.000  NR  ↓  Positivo  vitrite (coriorretinite após)+calcificação+hidrocefalia 
Negativo  NR  < 1:16  NR  ↑  Positivo  coriorretinite 
Negativo  NR  1:1024  162,0  ↔  Positivo  calcificação 
Negativo  Positivo  NR  200,0  ↑  Positivo  assintomático 
Negativo  Positivo  1:32.000  147,5  NR  Negativo  hidrocefalia 
Negativo  Negativo  1:8.000  312,0  ↑  Negativo  assintomático 
Negativo  Positivo  1:512.000  175,6  ↓  Negativo  assintomático 
10  Positivo  Positivo  1:512.000  188,1  ↓  Positivo  coriorretinite 
11  Negativo  Positivo  1:32.000  139,8  NR  Positivo  calcificação 
12  Positivo  Negativo  NR  84,8  ↑  Negativo  vitrite+calcificação 
13  Positivo  NR  NR  200,0  NR  Positivo  coriorretinite+calcificação 
14  Negativo  NR  NR  173,9  ↓  Positivo  coriorretinite+calcificação+hidrocefalia 
15  Positivo  NR  NR  1655,0  ↓  Negativo  coriorretinite+calcificação 

IFI, Imunofluorescência indireta para detecção de IgG anti‐T. gondii; NR, não realizada; QL, imunoensaio quimioluminescente de micropartículas para detecção de IgG anti‐T. gondii, expresso em UI/mL; RCP, reação em cadeia da polimerase para detecção do DNA de Toxoplasma gondii; ↑, aumento nos níveis de anticorpos IgG anti‐T. gondii em amostras de soro em série; ↔, persistência de níveis de IgG anti‐T. gondii em amostras de soro durante o acompanhamento; ↓, redução de anticorpos.

a

Amostra coletada no 1° mês de vida.

b

Amostra coletada nos primeiros 3 meses de vida, com todas as crianças em tratamento.

Entre as 15 crianças com TC, o teste IgG‐WB foi positivo em nove (60%) e entre as 32 crianças sem TC o teste foi positivo em 18 (56,3%), o que resultou em uma sensibilidade de 60% (IC de 95%, 32,3 a 83,7%), especificidade de 43,7% (IC de 95%, 26,4 a 62,3%), VPP de 33,3% (IC de 95%, 16,5 a 54,0%) e VPN de 70% (IC de 95%, 45,7 a 88,1%) (p=0,05875). Entre as crianças com TC, duas apresentaram IgG‐WB negativo e IgM anti‐T. gondii positivo; cinco apresentaram IgG‐WB positivo e IgM anti‐T. gondii negativo; quatro apresentaram ambos os testes positivos e quatro apresentaram ambos os testes negativos.

O peso molecular (PM) da proteína reconhecida pelo IgG anti‐T. gondii no soro de crianças com TC variou de 2 a 94kDa e o PM das proteínas reconhecidas pelos anticorpos IgG no soro das crianças não infectadas variou de 1 a 160kDa. Entre as nove crianças diagnosticadas por meio do IgG‐WB, sete apresentaram bandas diferentes daquelas observadas no soro materno e duas apresentaram bandas de maior intensidade do que aquelas apresentadas pelas amostras de suas mães. As bandas dominantes reconhecidas pelos anticorpos IgG em amostras de crianças com TC e em crianças não infectadas são apresentadas na figura 2.

Figura 2.

Distribuição das proteínas de Toxoplasma gondii mais frequentes reconhecidas por anticorpos IgG no soro de crianças com toxoplasmose congênita e crianças sem a doença, de acordo com seu peso molecular (kDa) (p > 0,05 para todas as proteínas reconhecidas).

(0,08MB).

Quanto às 26 amostras de pacientes com outras doenças, duas não apresentaram reatividade e 24 apresentaram reatividade de anticorpos IgG, que reconheceram proteínas com PM entre 17 e 118kDa. As proteínas reconhecidas com mais frequência foram p22 (11/40,7%), p34 (9/33,3%), p38 (8/29,6%), p94 (6/22,2%), p56 (5/18,5%) e p30 (5/18,5%).

A análise dos resultados de IgM anti‐T gondii com QL apresentou sensibilidade de 40% (IC de 95%, 16,3 a 67,6%), especificidade de 100% (IC de 95%, 89,1 a 100%), VPP de 100% (IC de 95%, 54,1 a 100%) e VPN de 78,1% (IC de 95%, 62,4 a 89,4%) (p=0,0005). No que diz respeito à detecção do DNA do parasita com RCP, a sensibilidade foi de 71,4% (IC de 95%, 29 a 96,3%), especificidade de 100% (IC de 95%, 69,2 a 100%), VPP de 100% (IC de 95%, 47,8 a 100%) e VPN de 83,3% (IC de 95%, 51,6 a 98%) (p=0,0034).

A sensibilidade e a especificidade do IgG‐WB, quando relacionadas a outros marcadores de TC, como a presença de IgM anti‐T gondii, RCP positiva e sintomas clínicos, são apresentadas na tabela 2.

Tabela 2.

Sensibilidade e especificidade do método Western Blotting para detecção de IgG anti‐Toxoplasma gondii (IgG‐WB), IgM anti‐Toxoplasma gondii, reação em cadeia da polimerase (RCP) ao Toxoplasma gondii e presença de sintomas clínicos compatíveis com a toxoplasmose congênita, avaliados em série e paralelamente, de acordo com a presença ou ausência de toxoplasmose congênita

Teste  Sensibilidade (%)  Especificidade (%) 
IgG‐WB +  60  43,7 
IgM T. gondii40  100 
IgM anti‐T. gondii ou IgG‐WB +  76  43,7 
IgM anti‐T. gondii e IgG‐WB +  24  100 
RCP +  71,7  100 
RCP+ou IgG‐WB +  89,1  43,7 
RCP+e IgG‐WB +  42,6  100 
Sintomas +  80  100 
Sintomas+ou IgG‐WB +  92  43,7 
Sintomas+e IgG‐WB +  48  100 

IgG‐WB, Western Blotting para diagnóstico de infecção congênita com detecção de anticorpos IgG; IgM anti‐Toxoplasma gondii detectado por quimiluminescência; Sintomas, presença de sintomas e/ou sinais clínicos compatíveis com toxoplasmose congênita;+ teste positivo

O IgG‐WB foi positivo em seis dos nove pacientes (66,7%) com lesões oculares e em três dos seis pacientes (50%) com TC sem lesões oculares (p=0,6224), com sensibilidade de 66,7% (IC de 95%, 29,9 a 92,5%), especificidade de 50% (IC de 95%, 11,8 a 88,2%), VPP de 66,7% (IC de 95%, 29,9 a 92,5%) e VPN de 50% (IC de 95%, 11,8 a 88,2%).

Discussão

O diagnóstico da TC é um desafio na prática clínica, porque a sensibilidade do IgM anti‐T. gondii com métodos sorológicos convencionais varia amplamente, de 48,3% a 75%.3–5 A ausência de IgM anti‐T. gondii pode ser justificada pelo fato de a infecção fetal ter ocorrido no início da gravidez ou como resultado de o tratamento materno para toxoplasmose ter sido feito durante os dois primeiros trimestres de gravidez, o que teria causado o bloqueio da resposta imune ou seu atraso.20 Ademais, o atraso ou a ausência de resposta imune detectável por métodos padrão (dosagem de IgG e IgM ou WB) pode estar relacionado a diferenças na resposta imune individual. Outra desvantagem desse marcador é o atraso na coleta de amostras, com positividade reduzida de IgM depois dos primeiros 30 dias de vida.21 Assim, muitas vezes é necessário monitorar os resultados sorológicos com a identificação de títulos estáveis ou crescentes de IgG anti‐T. gondii, que atrasam o diagnóstico e causam incerteza à família.16 Nesse contexto, o IgG‐WB pode ser usado para comparar os padrões de anticorpos com o T. gondii em amostras de soro das mães e de seus filhos e para determinar se os anticorpos são transmitidos passivamente ou sintetizados pelo feto ou neonato em casos de TC.15

Outros autores observaram uma maior contribuição do IgG‐WB para o diagnóstico de TC nos primeiros meses de vida.22,23 Além disso, a associação do IgG‐WB com outros métodos sorológicos pode aumentar a probabilidade do diagnóstico. Em uma coorte de crianças, a sensibilidade do IgG‐WB era de 82,4% e aumentou para 85,7% quando o IgG‐WB era associado à presença dos anticorpos IgM e/ou IgA anti‐T. gondii com o Elisa.16 Outro estudo mostrou que a combinação dos testes de imunocaptura de IgA e IgM, a análise dos padrões do WB para IgG e IgM e a combinação das duas técnicas permitiram a detecção de 94%, 94% e 100% dos casos, respectivamente.24

Os resultados do IgG‐WB obtidos no presente estudo estão próximos daqueles encontrados por outros autores, que relataram uma sensibilidade de 73,5%.18 Esses mesmos autores relataram que a combinação de IgG‐WB e IgM‐WB aumentou a sensibilidade para 86,5%.18

A sensibilidade mais baixa obtida neste estudo pode ser explicada, em parte, devido ao fato de todos os pacientes com suspeita de TC terem sido tratados com sulfadiazina, pirimetamina e ácido folínico durante a investigação, o que poderia inibir a neossíntese de anticorpos.20

Outra estratégia para melhorar a sensibilidade desse método proposto é a repetição do IgG‐WB durante os primeiros 3 meses de vida.8 Em um estudo com coleta de amostras no nascimento, a sensibilidade do anticorpo IgM anti‐T. gondii por métodos convencionais (reação de aglutinação por imunoabsorção [Isaga] e Elisa) foi de 52% e pelo método WB (com IgG e IgM), de 67%. Ao combinar ambos os métodos, a sensibilidade aumentou para 78% no nascimento e 85% nos primeiros 3 meses de vida, com detecção de 94% dos casos de TC.17

Neste estudo, analisamos algumas amostras sequenciais do IgG‐WB. Entre as crianças infectadas com resultado falso negativo na primeira amostra segundo o método IgG‐WB, duas de seis (33,3%) reconheceram proteínas diferentes em comparação com a amostra materna na segunda coleta, o que caracterizou a neossíntese de IgG anti‐T. gondii e justifica a necessidade da repetição do IgG‐WB em amostras em série.

Em uma análise anterior, o momento da coleta da amostra materna influenciou o resultado do teste IgG‐WB, pois as mães que receberam tratamento para toxoplasmose durante a gravidez podem deixar de reagir aos antígenos de T. gondii no período posterior ao nascimento, com resultado falso negativo.16 Neste estudo, esse fenômeno foi observado em uma mãe de uma criança infectada. Contudo, a maior parte das mães apresentou um aumento no número de bandas reconhecidas nas amostras coletadas imediatamente após a interrupção do tratamento no parto.

Em um estudo anterior, o PM de bandas antigênicas reconhecidas pela IgG de neonatos com TC variou entre 21 e 116kDa.18 Neste estudo, semelhantemente aos dados encontrados por outros autores,15,16 os anticorpos encontrados com alta frequência em crianças infectadas foram aqueles relacionados às proteínas de PM maiores do que 30kDa. As diferenças no PM de proteínas reconhecidas relatadas em estudos anteriores podem ser explicadas por diferentes exigências metodológicas, como a preparação do antígeno de T. gondii, as condições da eletroforese em gel de acrilamida e as diluições de soro.20 Outra explicação é a diversidade genética entre as cepas de T. gondii, o que pode levar ao reconhecimento de diferentes proteínas, além do fato de alguns indivíduos apresentarem IgG que reconhece várias proteínas, ao passo que outros apresentam IgG que reconhece uma única proteína.25

Neste estudo, o IgG‐WB também foi útil na demonstração da síntese ativa de IgG anti‐T. gondii em pacientes com IgG não reativa pelos métodos convencionais. No Paciente 4, com títulos de IgG anti‐T. gondii<1:16, por IFI, na primeira amostra e com um ligeiro aumento em amostras sequenciais (máximo de 1:64), observou‐se o desaparecimento de anticorpos IgG na avaliação pelos métodos de QL e IFI após o tratamento. Contudo, pelo método IgG‐WB, foi possível demonstrar o anticorpo IgG anti‐T. gondii, que reconheceu as proteínas p22 e p46, ausentes no soro materno. Após 12 meses de vida, essa criança que apresentou cicatrizes coriorretinianas continuou não reativa a anticorpos IgG anti‐T. gondii avaliados por QL e IFI; contudo, apresentou resultado positivo no IgG‐WB.

A TC com não reatividade para IgG e IgM anti‐T. gondii poderá ser resultante do tratamento de toxoplasmose na mãe e no neonato.20 O tratamento da criança durante um ano após o nascimento também poderá causar anticorpo não reativo. Contudo, na maioria desses casos, há a detecção de IgG anti‐T. gondii logo após a interrupção do tratamento, denominada efeito rebote.1,7,20

No presente estudo, o Paciente 1 mostrou não reatividade; mas apresentou anticorpos anti‐T. gondii detectáveis após a interrupção do tratamento. Semelhantemente ao Paciente 4, os pacientes 6, 8 e 9 também mostraram uma queda nos anticorpos até a não reatividade e assim permaneceram após a interrupção do tratamento. Existe a possibilidade de que esses pacientes deixem de reconhecer as proteínas p30 e p35 presentes no teste de QL, o que justifica a não reatividade nesse teste com a evolução da infecção.

Portanto, em vez de avaliar somente a persistência de IgG anti‐T. gondii por meio de QL, sugerimos o uso do IgG‐WB no monitoramento sorológico, pois a criança infectada pode produzir anticorpos contra outras proteínas do parasita e, assim, continuar positiva após 12 meses de idade. Nesse caso, a ausência de IgG anti‐T. gondii na QL não poderá excluir a TC, o que também justificaria a menor especificidade do IgG‐WB encontrada durante este estudo em comparação com estudos anteriores.16–18,22,23 Contudo, mais estudos devem ser feitos antes do uso do IgG‐WB no monitoramento sorológico.

De acordo com um estudo feito na população brasileira, pacientes com IgM reativa pelo método WB (IgM‐WB) mostraram maior risco de lesão macular ativa do que pacientes com IgM‐WB negativo.18 Contudo, nenhuma diferença significativa foi encontrada entre a positividade do IgG‐WB e a presença de lesão macular, como neste estudo. Não é elucidado se há proteínas específicas de cepas de T. gondii relacionadas a lesões oculares e se elas poderiam explicar a maior frequência de lesões oculares em crianças brasileiras com TC do que em crianças de outros países.26 A principal limitação deste estudo foi a ausência de avaliação das amostras com o IgM‐WB, o que poderia melhorar a sensibilidade de diagnóstico do teste.

O procedimento técnico do IgG‐WB é de baixa complexidade e de custo disponível, o que o torna viável na rotina laboratorial. A desvantagem do método interno é sua lentidão, que poderia ser reduzida com a padronização de um conjunto de reagentes de fabricação nacional. A semiautomação do método com o uso de um programa para leitura da intensidade da banda visualizada por meio do WB facilitaria a leitura e a reprodutibilidade dos resultados.20

Os resultados reforçam a utilidade do método IgG‐WB para avaliação sorológica de pacientes com TC, com maior sensibilidade do que a detecção de IgM anti‐T. gondii por métodos convencionais. Portanto, o IgG‐WB pode ser usado para obter o diagnóstico precoce de TC em combinação com outros marcadores da infecção congênita por T. gondii.

Financiamento

Programa de Apoio à Extensão Universitária do Ministério da Educação do Brasil (Proext–MEC/SESu) e Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq).

Conflitos de interesse

Os autores declaram não haver conflitos de interesse.

Agradecimentos

A todos os pacientes e parentes que contribuíram para este trabalho, ao Programa de Pós‐Graduação em Ciências da Saúde da Universidade Estadual de Londrina (UEL) e ao Programa de Pós‐Graduação em Ciência Animal da UEL.

Referências
[1]
J.S. Remington, R. McLeod, C.B. Wilson, G. Desmonts.
Toxoplasmosis.
Infectious disease of the fetus and newborn infant, 7 ed., pp. 918-1041
[2]
American Academy of Pediatrics.
Report of committee on infectious diseases. Toxoplasma gondii infections (Toxoplasmosis).
28ª ed., Elk Grove Village, (2009), pp. 667-672
[3]
M. Lebech, O. Andersen, N.C. Christensen, J. Hertel, H.E. Nielsen, B. Peitersen, et al.
Feasibility of neonatal screening for toxoplasma infection in the absence of prenatal treatment. Danish Congenital Toxoplasmosis Study Group.
Lancet, 353 (1999), pp. 1834-1837
[4]
E.G. Lago, E.C. Neto, J. Melamed, A.P. Rucks, C. Presotto, J.C. Coelho, et al.
Congenital toxoplasmosis: late pregnancy infections detected by neonatal screening and maternal serological testing at delivery.
Paediatr Perinat Epidemiol, 21 (2007), pp. 525-531
[5]
J.D. Capobiango, R. Mitsuka-Breganó, I.T. Navarro, C.P. Rezende Neto, A.M. Casella, F.M. Lopes-Mori, et al.
Congenital toxoplasmosis in a reference center of Paraná, Southern Brazil.
Braz J Infect Dis, 18 (2014), pp. 364-371
[6]
I.M. Rodrigues, A.M. Castro, M.B. Gomes, W.N. Amaral, M.M. Avelino.
Congenital toxoplasmosis: evaluation of serological methods for detection of anti‐Toxoplasma gondii IgM and IgA antibodies.
Mem Inst Oswaldo Cruz, 104 (2009), pp. 434-440
[7]
J.M. Pinon, H. Dumon, C. Chemla, J. Franck, E. Petersen, M. Lebech, et al.
Strategy for diagnosis of congenital toxoplasmosis: evaluation of methods comparing mothers and newborns and standard methods for postnatal detection of immunoglobulin G, M and A antibodies.
J Clin Microbiol, 39 (2001), pp. 2267-2271
[8]
D. Tissot-Dupont, H.H. Fricker, M.P. Pinchart, C. Bost-Bru, P.A. Thomas, H. Pelloux.
Usefulness of Western Blot in serological follow‐up of newborns suspected of congenital toxoplasmosis.
Eur J Clin Microbiol Infect Dis, 22 (2003), pp. 122-125
[9]
J.S. Remington, P. Thulliez, J.G. Montoya.
Recent developments for diagnosis of toxoplasmosis.
J Clin Microbiol, 42 (2004), pp. 941-945
[10]
Brasil. Ministério da Saúde. Secretaria de Atenção à Saúde. Departamento de Ações Programáticas Estratégicas.
Atenção à saúde do recém‐nascido: guia para os profissionais de saúde: intervenções comuns, icterícia e infecções.
2ª ed., Ministério da Saúde, (2013), pp. 109-122
[11]
M. Lebech, D.H. Joynson, H.M. Seitz, P. Thulliez, R.E. Gilbert, G.N. Dutton, et al.
Classification system and case definitions of Toxoplasma infection in immunocompetent pregnant women and their congenitally infected offspring.
Eur J Clin Microbiol Infect Dis, 15 (1996), pp. 799-805
[12]
M.E. Camargo.
Improved technique of indirect immunofluorescence for serological diagnosis of toxoplasmosis.
Rev Inst Med Trop, 6 (1964), pp. 117-118
[13]
A. Lundén.
Immune responses in sheep after immunization with Toxoplasma gondii antigens incorporated into iscoms.
Vet Parasitol, 56 (1995), pp. 23-25
[14]
O.H. Lowry, N.J. Rosebrough, A.L. Farr, R.J. Randall.
Protein measurement with the Folin phenol reagent.
J Biol Chem, 193 (1951), pp. 265-275
[15]
B.F. Chumpitazi, A. Boussaid, H. Pelloux, C. Racinet, M. Bost, A.G. Fleuret.
Diagnosis of congenital toxoplasmosis by immunoblotting and relationship with other methods.
J Clin Microbiol, 33 (1995), pp. 1479-1485
[16]
U. Gross, C.G. Lüder, V. Hendgen, C. Heeg, I. Sauer, A. Weidner, et al.
Comparative immunoglobulin G antibody profiles between mother and child (CGMC Test) for early diagnosis of congenital toxoplasmosis.
J Clin Microbiol, 38 (2000), pp. 3619-3622
[17]
V. Rilling, K. Dietz, D. Krczal, F. Knotek, G. Enders.
Evaluation of a commercial IgG/IgM western blot assay for early postnatal diagnosis of congenital toxoplasmosis.
Eur J Clin Microbiol Infect Dis, 22 (2003), pp. 174-180
[18]
A.S. Machado, G.M. Andrade, J.N. Januário, M.D. Fernandes, A.C. Carneiro, M. Carneiro, et al.
IgG and IgM western blot assay for diagnosis of congenital toxoplasmosis.
Mem Inst Oswaldo Cruz, 105 (2010), pp. 757-761
[19]
W.L. Homan, M. Vercammen, J. De Braekeleer, H. Verschueren.
Identification of a 200‐ to 300‐fold repetitive 529bp DNA fragment in Toxoplasma gondii, and its use for diagnostic and quantitative PCR.
Int J Parasitol, 30 (2000), pp. 69-75
[20]
A. Sensini.
Toxoplasma gondii infection in pregnancy: opportunities and pitfalls of serological diagnosis.
Clin Microbiol Infect, 12 (2006), pp. 504-512
[21]
E.G. Lago, A.P. Oliveira, A.L. Bender.
Presence and duration of anti‐Toxoplasma gondii immunoglobulin M in infants with congenital toxoplasmosis.
J Pediatr (Rio J), 90 (2014), pp. 363-369
[22]
B. Magi, L. Migliorini.
Western blotting for the diagnosis of congenital toxoplasmosis.
New Microbiol, 34 (2011), pp. 93-95
[23]
C. L’Ollivier, M. Wallon, B. Faucher, R. Piarroux, F. Peyron, J. Franck.
Comparison of mother and child antibodies that target high‐molecular‐mass Toxoplasma gondii antigens by immunoblotting improves neonatal diagnosis of congenital toxoplasmosis.
Clin Vaccine Immunol, 19 (2012), pp. 1326-1328
[24]
F.R. Gamgneux, V. Commere, C.T. Schaefer, J.D. Camet.
Performance of a Western Blot assay to compare mother and newborn anti‐Toxoplasma gondii antibodies for the early neonatal diagnosis of congenital toxoplasmosis.
Eur J Clin Microbiol Infect Dis, 18 (1999), pp. 648-654
[25]
X. Sun, H. Lu, B. Jia, Z. Chang, S. Peng, J. Yin, et al.
A comparative study of Toxoplasma gondii seroprevalence in three healthy Chinese populations detected using native and recombinant antigens.
Parasit Vectors, 6 (2013), pp. 241-247
[26]
R.E. Gilbert, K. Freeman, E.G. Lago, L.M. Bahia-Oliveira, H.K. Tan, M. Wallon, et al.
European Multicentre Study on Congenital Toxoplasmosis (EMSCOT). Ocular sequelae of congenital toxoplasmosis in Brazil compared with Europe.
PLoS Negl Trop Dis, 2 (2008), pp. 1-7

Como citar este artigo: Capobiango JD, Monica TC, Ferreira FP, Mitsuka‐Breganó R, Navarro IT, Garcia JL, et al. Evaluation of the Western blotting method for the diagnosis of congenital toxoplasmosis. J Pediatr (Rio J). 2016;92:616–23.

Estudo feito na Universidade Estadual de Londrina, Londrina, PR, Brasil.

Idiomas
Jornal de Pediatria

Receba a nossa Newsletter

Opções de artigo
Ferramentas
en pt
Taxa de publicaçao Publication fee
Os artigos submetidos a partir de 1º de setembro de 2018, que forem aceitos para publicação no Jornal de Pediatria, estarão sujeitos a uma taxa para que tenham sua publicação garantida. O artigo aceito somente será publicado após a comprovação do pagamento da taxa de publicação. Ao submeterem o manuscrito a este jornal, os autores concordam com esses termos. A submissão dos manuscritos continua gratuita. Para mais informações, contate assessoria@jped.com.br. Articles submitted as of September 1, 2018, which are accepted for publication in the Jornal de Pediatria, will be subject to a fee to have their publication guaranteed. The accepted article will only be published after proof of the publication fee payment. By submitting the manuscript to this journal, the authors agree to these terms. Manuscript submission remains free of charge. For more information, contact assessoria@jped.com.br.
Cookies policy Política de cookies
To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here. Utilizamos cookies próprios e de terceiros para melhorar nossos serviços e mostrar publicidade relacionada às suas preferências, analisando seus hábitos de navegação. Se continuar a navegar, consideramos que aceita o seu uso. Você pode alterar a configuração ou obter mais informações aqui.